Construct: ORF TRCN0000465258
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004899.1_s317c1
- Derived from:
- ccsbBroadEn_02580
- DNA Barcode:
- CTAGCTAATTCGCGGACTACCATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMED10 (10972)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465258
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10972 | TMED10 | transmembrane p24 trafficki... | NM_006827.6 | 100% | 100% | |
| 2 | human | 286102 | TMED10P1 | transmembrane p24 trafficki... | NR_002807.4 | 15% | (many diffs) | |
| 3 | mouse | 68581 | Tmed10 | transmembrane p24 trafficki... | NM_026775.4 | 89.5% | 92.6% | (many diffs) |
| 4 | mouse | 100042773 | Tmed10-ps | transmembrane p24 trafficki... | XR_873237.3 | 11.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 723
- ORF length:
- 657
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tggtttgtct ggcccaccag cccggcgcgg cccttttccg ttagcgttgc 121 tgcttttgtt cctgctcggc cccagattgg tccttgccat ctccttccat ctgcccatta 181 actctcgcaa gtgcctccgt gaggagattc acaaggacct gctagtgact ggcgcgtacg 241 agatctccga ccagtctggg ggcgctggcg gcctgcgcag ccacctcaag atcacagatt 301 ctgctggcca tattctctac tccaaagagg atgcaaccaa ggggaaattt gcctttacca 361 ctgaagatta tgacatgttT GAAGTGTGTT TTGAGAGCAA GGGAACAGGG CGGATACCTG 421 ACCAACTCGT GATCCTAGAC ATGAAGCATG GAGTGGAGGC GAAAAATTAC GAAGAGATTG 481 CAAAAGTTGA GAAGCTCAAA CCATTAGAGG TAGAGCTGCG ACGCCTAGAA GACCTTTCAG 541 AATCTATTGT TAATGATTTT GCCTACATGA AGAAGAGAGA AGAGGAGATG CGTGATACCA 601 ACGAGTCAAC AAACACTCGG GTCCTATACT TCAGCATCTT TTCAATGTTC TGTCTCATTG 661 GACTAGCTAC CTGGCAGGTC TTCTACCTGC GACGCTTCTT CAAGGCCAAG AAATTGATTG 721 AGTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 781 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 841 GGCTTTATAT ATCTTGTGGA AAGGACGACT AGCTAATTCG CGGACTACCA TCACGCGTTA 901 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt