Transcript: Mouse XR_873237.3

PREDICTED: Mus musculus transmembrane p24 trafficking protein 10, pseudogene (Tmed10-ps), misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tmed10-ps (100042773)
Length:
4916
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_873237.3
NBCI Gene record:
Tmed10-ps (100042773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_873237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348483 ACAGATTCTGCTGGCCATATT pLKO_005 3881 3UTR 100% 13.200 6.600 Y Tmed10 n/a
2 TRCN0000112381 CCTGACCAACTCGTGATTCTA pLKO.1 4004 3UTR 100% 5.625 2.813 Y Tmed10 n/a
3 TRCN0000112382 CGAGTCCATTGTTAATGACTT pLKO.1 4126 3UTR 100% 4.950 2.475 Y Tmed10 n/a
4 TRCN0000112380 GCCTTGTCCTTCACTCTAGTT pLKO.1 4679 3UTR 100% 4.950 2.475 Y Tmed10 n/a
5 TRCN0000335052 GCCTTGTCCTTCACTCTAGTT pLKO_005 4679 3UTR 100% 4.950 2.475 Y Tmed10 n/a
6 TRCN0000112383 CCGGGTCCTGTACTTCAGCAT pLKO.1 4204 3UTR 100% 0.880 0.440 Y Tmed10 n/a
7 TRCN0000334979 CCGGGTCCTGTACTTCAGCAT pLKO_005 4204 3UTR 100% 0.880 0.440 Y Tmed10 n/a
8 TRCN0000029148 CGCTTCTTCAAGGCCAAGAAA pLKO.1 4280 3UTR 100% 0.563 0.281 Y TMED10 n/a
9 TRCN0000278533 CGCTTCTTCAAGGCCAAGAAA pLKO_005 4280 3UTR 100% 0.563 0.281 Y TMED10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_873237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02580 pDONR223 100% 11.9% None (many diffs) n/a
2 ccsbBroad304_02580 pLX_304 0% 11.9% V5 (many diffs) n/a
3 TRCN0000465258 CTAGCTAATTCGCGGACTACCATC pLX_317 52.2% 11.9% V5 (many diffs) n/a
Download CSV