Transcript: Human NM_006827.6

Homo sapiens transmembrane p24 trafficking protein 10 (TMED10), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TMED10 (10972)
Length:
4109
CDS:
34..693

Additional Resources:

NCBI RefSeq record:
NM_006827.6
NBCI Gene record:
TMED10 (10972)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006827.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029147 GAGATTCACAAGGACCTGCTA pLKO.1 172 CDS 100% 2.640 1.848 N TMED10 n/a
2 TRCN0000278583 GAGATTCACAAGGACCTGCTA pLKO_005 172 CDS 100% 2.640 1.848 N TMED10 n/a
3 TRCN0000029148 CGCTTCTTCAAGGCCAAGAAA pLKO.1 661 CDS 100% 0.563 0.394 N TMED10 n/a
4 TRCN0000278533 CGCTTCTTCAAGGCCAAGAAA pLKO_005 661 CDS 100% 0.563 0.394 N TMED10 n/a
5 TRCN0000029146 CAACAAACACTCGGGTCCTAT pLKO.1 575 CDS 100% 4.950 2.970 N TMED10 n/a
6 TRCN0000278539 CAACAAACACTCGGGTCCTAT pLKO_005 575 CDS 100% 4.950 2.970 N TMED10 n/a
7 TRCN0000029145 CCAACTCGTGATCCTAGACAT pLKO.1 390 CDS 100% 4.950 2.970 N TMED10 n/a
8 TRCN0000278584 CCAACTCGTGATCCTAGACAT pLKO_005 390 CDS 100% 4.950 2.970 N TMED10 n/a
9 TRCN0000029144 CGCCTAGAAGACCTTTCAGAA pLKO.1 490 CDS 100% 4.950 2.970 N TMED10 n/a
10 TRCN0000278585 CGCCTAGAAGACCTTTCAGAA pLKO_005 490 CDS 100% 4.950 2.970 N TMED10 n/a
11 TRCN0000348483 ACAGATTCTGCTGGCCATATT pLKO_005 262 CDS 100% 13.200 6.600 Y Tmed10 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3393 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3430 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3264 3UTR 100% 4.950 2.475 Y C16orf89 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3430 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006827.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02580 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02580 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465258 CTAGCTAATTCGCGGACTACCATC pLX_317 52.2% 100% 100% V5 n/a
Download CSV