Construct: ORF TRCN0000465310
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002823.1_s317c1
- Derived from:
- ccsbBroadEn_02217
- DNA Barcode:
- GCACACGTCCTCGGGAGCTTGCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FEZ1 (9638)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465310
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9638 | FEZ1 | fasciculation and elongatio... | NM_005103.5 | 100% | 100% | |
| 2 | human | 9638 | FEZ1 | fasciculation and elongatio... | XM_005271734.2 | 100% | 100% | |
| 3 | human | 9638 | FEZ1 | fasciculation and elongatio... | XM_005271735.2 | 100% | 100% | |
| 4 | human | 9638 | FEZ1 | fasciculation and elongatio... | NM_022549.3 | 26.5% | 26.5% | 312_313ins864 |
| 5 | mouse | 235180 | Fez1 | fasciculation and elongatio... | NM_183171.4 | 91.1% | 95.4% | (many diffs) |
| 6 | mouse | 235180 | Fez1 | fasciculation and elongatio... | XM_006510227.3 | 91.1% | 95.4% | (many diffs) |
| 7 | mouse | 235180 | Fez1 | fasciculation and elongatio... | XM_006510228.3 | 91.1% | 95.4% | (many diffs) |
| 8 | mouse | 235180 | Fez1 | fasciculation and elongatio... | XM_006510229.3 | 91.1% | 95.4% | (many diffs) |
| 9 | mouse | 235180 | Fez1 | fasciculation and elongatio... | XM_017313312.1 | 91.1% | 95.4% | (many diffs) |
| 10 | mouse | 235180 | Fez1 | fasciculation and elongatio... | XM_017313313.1 | 91.1% | 95.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggccccactg gtgagtctgg atgaagagtt tgaggacctt cgaccctcct 121 gctcggagga cccggaggag aagccccagt gtttctatgg ttcatctccc caccatctcg 181 aggacccctc cctctccgag cttgagaatt tttcttccga aataatcagc ttcaagtcca 241 tggaggacct cgtaaatgaa tttgatgaga agctcaatgt ctgctttcgg aactacaacg 301 ccaagaccga gaacctagct cccgtgaaga accagttaca gatccaagag gaggaggaga 361 cccttcagga cgaggaggtt tgggatgctc tgacagacaa ttacatccct tcactctcag 421 aagactggag ggatccaaac atcgaggctc tgaatggcaa ctgctctgac actgagatcc 481 atgagaaaga agaggaagag ttcaatgaga agagtgaaaa tgattccggt atcaacgagg 541 agcctctgct cacagcagat caggtaattg aggagattga ggaaatgatg cagaactccc 601 cagaccctga ggaagaagag gaggttctgg aagaagagga tggaggagaa acttcctccc 661 aggcagactc ggtcctcctg caggagatgc aggcattgac acagaccttc aacaacaact 721 ggtcctatga agggctgagg cacatgtctg ggtctgagct gaccgagctg ctggaccagg 781 tggagggtgc catccgtgac ttctcggagg agctggtgca gcagctggcc cgccgggacg 841 agctggagtt TGAGAAGGAA GTGAAGAACT CCTTTATCAC GGTGCTTATT GAGGTTCAGA 901 ACAAGCAGAA GGAGCAGCGA GAACTGATGA AAAAGAGGCG GAAAGAGAAA GGGCTGAGCC 961 TGCAGAGCAG CCGGATAGAG AAGGGAAACC AGATGCCTCT CAAGCGCTTC AGCATGGAAG 1021 GCATCTCCAA CATTCTGCAG AGTGGCATCC GCCAGACCTT TGGCTCCTCA GGAACTGACA 1081 AACAGTATCT GAACACAGTC ATTCCTTACG AGAAGAAAGC CTCTCCTCCC TCAGTGGAAG 1141 ACCTGCAGAT GCTGACAAAC ATTCTCTTTG CCATGAAGGA GGATAATGAG AAGGTGCCTA 1201 CTTTGCTAAC GGACTACATT TTAAAAGTGC TCTGCCCTAC CTACCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGAGCA CACGTCCTCG GGAGCTTGCG TACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t