Transcript: Human NM_022549.3

Homo sapiens fasciculation and elongation protein zeta 1 (FEZ1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
FEZ1 (9638)
Length:
1836
CDS:
236..550

Additional Resources:

NCBI RefSeq record:
NM_022549.3
NBCI Gene record:
FEZ1 (9638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330331 TCCATGGAGGACCTCGTAAAT pLKO_005 407 CDS 100% 13.200 18.480 N FEZ1 n/a
2 TRCN0000062678 CCCAGTGTTTCTATGGTTCAT pLKO.1 315 CDS 100% 4.950 6.930 N FEZ1 n/a
3 TRCN0000062682 GCTCAATGTCTGCTTTCGGAA pLKO.1 442 CDS 100% 2.640 1.848 N FEZ1 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1572 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1572 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022549.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02217 pDONR223 100% 26.5% 26.5% None 312_313ins864 n/a
2 ccsbBroad304_02217 pLX_304 0% 26.5% 26.5% V5 312_313ins864 n/a
3 TRCN0000465310 GCACACGTCCTCGGGAGCTTGCGT pLX_317 33.6% 26.5% 26.5% V5 312_313ins864 n/a
Download CSV