Construct: ORF TRCN0000465323
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007851.1_s317c1
- Derived from:
- ccsbBroadEn_06614
- DNA Barcode:
- CACTGGCTCCTTCTACCGCATGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAP1L1 (4673)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465323
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4673 | NAP1L1 | nucleosome assembly protein... | NM_001330231.2 | 99.8% | 100% | 300C>T;471A>G |
| 2 | human | 4673 | NAP1L1 | nucleosome assembly protein... | NM_004537.7 | 99.8% | 100% | 300C>T;471A>G |
| 3 | human | 4673 | NAP1L1 | nucleosome assembly protein... | NM_139207.5 | 99.8% | 100% | 300C>T;471A>G |
| 4 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XM_011538393.2 | 99.8% | 100% | 300C>T;471A>G |
| 5 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XM_017019338.1 | 99.8% | 100% | 300C>T;471A>G |
| 6 | human | 4673 | NAP1L1 | nucleosome assembly protein... | NM_001307924.3 | 95.1% | 92.1% | (many diffs) |
| 7 | human | 4673 | NAP1L1 | nucleosome assembly protein... | NM_001330232.2 | 83.5% | 82.6% | (many diffs) |
| 8 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XM_017019339.1 | 83.5% | 82.6% | (many diffs) |
| 9 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XM_017019340.2 | 83.5% | 82.6% | (many diffs) |
| 10 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XM_024448983.1 | 83.5% | 82.6% | (many diffs) |
| 11 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XR_001748715.2 | 37.2% | (many diffs) | |
| 12 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XR_001748714.2 | 36.9% | (many diffs) | |
| 13 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XR_001748716.1 | 34.1% | (many diffs) | |
| 14 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XR_001748717.2 | 34% | (many diffs) | |
| 15 | human | 4673 | NAP1L1 | nucleosome assembly protein... | XR_002957328.1 | 30.4% | (many diffs) | |
| 16 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | NM_015781.4 | 93.4% | 98.2% | (many diffs) |
| 17 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | NM_001146707.1 | 87.4% | 91.8% | (many diffs) |
| 18 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | XM_006513890.3 | 87.4% | 91.8% | (many diffs) |
| 19 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | XM_006513893.3 | 77% | 81.5% | (many diffs) |
| 20 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | XR_001779557.1 | 44.9% | (many diffs) | |
| 21 | mouse | 53605 | Nap1l1 | nucleosome assembly protein... | XR_001779558.1 | 27.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1239
- ORF length:
- 1173
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttngcatggc agacattgac aacaaagaac agtctgaact tgatcaagat ttggatgatg 121 ttgaagaagt agaagaagag gaaactggtg aagaaacaaa actcaaagca cgtcagctaa 181 ctgttcagat gatgcaaaat cctcagattc ttgcagccct tcaagaaaga cttgatggtc 241 tggtagaaac accaacagga tacattgaaa gcctgcctag ggtagttaaa agacgagtga 301 atgctctcaa aaacctgcaa gttaaatgtg cacagataga agccaaattc tatgaggaag 361 ttcatgatct tgaaaggaag tatgctgttc tctatcagcc tctatttgat aagcgatttg 421 aaattattaa tgcaatttat gaacctacgg aagaagaatg tgaatggaaa ccagatgaag 481 aagatgagat ttcggaggaa ttgaaagaaa aggccaagat tgaagatgag aaaaaggatg 541 aagaaaaaga agaccccaaa ggaattcctg aattttggtt aactgttttt aagaatgttg 601 acttgctcag tgatatggtt caggaacacg atgaacctat tctgaagcac ttgaaagata 661 ttaaagtgaa gttctcagat gctggccagc ctatgagttt tgtcttagaa tttcactttg 721 aacccaatga atattttaca aatgaagtgc tgacaaagac atacaggatg aggtcagaac 781 cagatgattc tgatcccttt tcttttgatg gaccagaaat tatgggttgt acagggtgcc 841 agatagattG GAAAAAAGGA AAGAATGTCA CTTTGAAAAC TATTAAGAAG AAGCAGAAAC 901 ACAAGGGACG TGGGACAGTT CGTACTGTGA CTAAAACAGT TTCCAATGAC TCTTTCTTTA 961 ACTTTTTTGC CCCTCCTGAA GTTCCTGAGA GTGGAGATCT GGATGATGAT GCTGAAGCTA 1021 TCCTTGCTGC AGACTTCGAA ATTGGTCACT TTTTACGTGA GCGTATAATC CCAAGATCAG 1081 TGTTATATTT TACTGGAGAA GCTATTGAAG ATGATGATGA TGATTATGAT GAAGAAGGTG 1141 AAGAAGCGGA TGAGGAAGGG GAAGAAGAAG GAGATGAGGA AAATGATCCA GACTATGACC 1201 CAAAGAAGGA TCAAAACCCA GCAGAGTGCA AGCAGCAGTG CCCAACTTTC TTGTACAAAG 1261 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1321 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1381 ACGACACTGG CTCCTTCTAC CGCATGGGAC GCGTTAAGTC gacaatcaac ctctggatta 1441 caaaatttgt gaaagatt