Transcript: Human XM_017019339.1

PREDICTED: Homo sapiens nucleosome assembly protein 1 like 1 (NAP1L1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAP1L1 (4673)
Length:
2967
CDS:
400..1386

Additional Resources:

NCBI RefSeq record:
XM_017019339.1
NBCI Gene record:
NAP1L1 (4673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427064 GAAGCACTTGAAAGATATTAA pLKO_005 789 CDS 100% 15.000 10.500 N Nap1l1 n/a
2 TRCN0000148741 CCTATTCTGAAGCACTTGAAA pLKO.1 781 CDS 100% 5.625 3.938 N NAP1L1 n/a
3 TRCN0000280693 CCTATTCTGAAGCACTTGAAA pLKO_005 781 CDS 100% 5.625 3.938 N NAP1L1 n/a
4 TRCN0000149921 GCCAAGATTGAAGATGAGAAA pLKO.1 658 CDS 100% 4.950 2.970 N NAP1L1 n/a
5 TRCN0000280626 GCCAAGATTGAAGATGAGAAA pLKO_005 658 CDS 100% 4.950 2.970 N NAP1L1 n/a
6 TRCN0000280694 TTCTCTATCAGCCTCTATTTG pLKO_005 533 CDS 100% 13.200 6.600 Y NAP1L1 n/a
7 TRCN0000092890 GCCAAATTCTATGAGGAAGTT pLKO.1 487 CDS 100% 4.950 2.475 Y Nap1l1 n/a
8 TRCN0000149872 GCCAAATTCTATGAGGAAGTT pLKO.1 487 CDS 100% 4.950 2.475 Y NAP1L1 n/a
9 TRCN0000280692 GCCAAATTCTATGAGGAAGTT pLKO_005 487 CDS 100% 4.950 2.475 Y NAP1L1 n/a
10 TRCN0000149610 GAAGCCAAATTCTATGAGGAA pLKO.1 484 CDS 100% 2.640 1.320 Y NAP1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06614 pDONR223 100% 83.5% 82.6% None (many diffs) n/a
2 ccsbBroad304_06614 pLX_304 0% 83.5% 82.6% V5 (many diffs) n/a
3 TRCN0000465323 CACTGGCTCCTTCTACCGCATGGG pLX_317 33.5% 83.5% 82.6% V5 (many diffs) n/a
Download CSV