Construct: ORF TRCN0000465330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012727.1_s317c1
- Derived from:
- ccsbBroadEn_09260
- DNA Barcode:
- CGATGGGTATCCCTGACTGTTAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EAF1 (85403)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 85403 | EAF1 | ELL associated factor 1 | NM_033083.7 | 99.6% | 99.2% | 186G>T;290A>T;754A>G |
| 2 | human | 85403 | EAF1 | ELL associated factor 1 | XM_005265518.2 | 62% | 58.2% | (many diffs) |
| 3 | human | 85403 | EAF1 | ELL associated factor 1 | XM_011534165.1 | 62% | 58.2% | (many diffs) |
| 4 | human | 85403 | EAF1 | ELL associated factor 1 | XM_011534166.1 | 62% | 58.2% | (many diffs) |
| 5 | mouse | 74427 | Eaf1 | ELL associated factor 1 | NM_028932.4 | 88.6% | 97.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 870
- ORF length:
- 804
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa tgggaccgca aacccgctgc tggaccgcga ggaacattgc ctgaggctcg 121 gggagagctt cgagaagcgg ccgcgggcct ccttccacac tattcgttat gattttaaac 181 cagcatctat agacacttcc tgtgaaggag agcttcaagt tggcaaagga gatgaagtca 241 caattacact tccacatatc cctggatcca caccacccat gactgtgttc aaggggaaca 301 aacggcctta ccagaaagac tgtgtgctta ttattaatca tgacactggt gaatttgtgc 361 tggaaaaact cagtagcagc attcaggtga agaaaacaag agctgagggc agcagtaaaa 421 tccaggcccg aatggaacag cagcccactc gtcctccaca gacgtcacag ccaccaccac 481 ctccaccacc TATGCCATTC AGAGCTCCAA CGAAGCCTCC AGTTGGACCC AAAACTTCTC 541 CCTTGAAAGA TAACCCCTCA CCTGAACCTC AGTTGGATGA CATCAAAAGA GAGCTGAGGG 601 CTGAAGTTGA CATTATTGAA CAAATGAGCA GCAGCAGTGG GAGCAGCTCT TCAGACTCTG 661 AGAGCTCTTC GGGAAGTGAT GACGATAGCT CCAGCAGTGG AGGCGAGGAC AATGGCCCAG 721 CCTCTCCTCC GCAGCCTTCA CACCAGCAGC CCTACAACAG TAGGCCTGCC GTTGCCAATG 781 GAACCAGCCG GCCACAAGGA AGCAACCAGC TCATGAACGC CCTCAGAAAT GACTTGCAGT 841 TGAGTGAGTC TGGCAGTGAC AGTGATGACT ACCCAACTTT CTTGTACAAA GTGGTTGATA 901 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 961 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACGATG 1021 GGTATCCCTG ACTGTTAGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1081 tgaaagatt