Transcript: Mouse NM_028932.4

Mus musculus ELL associated factor 1 (Eaf1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Eaf1 (74427)
Length:
4238
CDS:
191..997

Additional Resources:

NCBI RefSeq record:
NM_028932.4
NBCI Gene record:
Eaf1 (74427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_028932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241403 AGGGCCGAGGTGGACATTATT pLKO_005 722 CDS 100% 15.000 21.000 N Eaf1 n/a
2 TRCN0000241402 ATGGGTAAGCCCTGGTATATA pLKO_005 3223 3UTR 100% 15.000 21.000 N Eaf1 n/a
3 TRCN0000194582 CCACACGATTCGCTACGATTT pLKO.1 280 CDS 100% 10.800 15.120 N Eaf1 n/a
4 TRCN0000241405 CCACACGATTCGCTACGATTT pLKO_005 280 CDS 100% 10.800 15.120 N Eaf1 n/a
5 TRCN0000241404 CGCCAATGACGGTGTTCAAAG pLKO_005 399 CDS 100% 10.800 15.120 N Eaf1 n/a
6 TRCN0000215364 GAAAGACTGTGTGCTCATTAT pLKO.1 439 CDS 100% 13.200 9.240 N Eaf1 n/a
7 TRCN0000241401 GAAAGACTGTGTGCTCATTAT pLKO_005 439 CDS 100% 13.200 9.240 N Eaf1 n/a
8 TRCN0000173531 GCACTCAGATACTCAGTCTTT pLKO.1 1122 3UTR 100% 4.950 3.465 N Eaf1 n/a
9 TRCN0000435898 ACCAGCAGCCCTACAACAGTA pLKO_005 867 CDS 100% 4.950 3.465 N EAF1 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2523 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_028932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09260 pDONR223 100% 88.6% 97.3% None (many diffs) n/a
2 ccsbBroad304_09260 pLX_304 0% 88.6% 97.3% V5 (many diffs) n/a
3 TRCN0000465330 CGATGGGTATCCCTGACTGTTAGA pLX_317 47.3% 88.6% 97.3% V5 (many diffs) n/a
Download CSV