Transcript: Human XM_005265518.2

PREDICTED: Homo sapiens ELL associated factor 1 (EAF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EAF1 (85403)
Length:
4293
CDS:
332..835

Additional Resources:

NCBI RefSeq record:
XM_005265518.2
NBCI Gene record:
EAF1 (85403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157369 CTTCGGGAAGTGATGACGATA pLKO.1 630 CDS 100% 4.950 6.930 N EAF1 n/a
2 TRCN0000420895 TGAACCTCAGTTGGATGACAT pLKO_005 526 CDS 100% 4.950 6.930 N EAF1 n/a
3 TRCN0000417781 CCATTCAGAGCTCCAACGAAG pLKO_005 458 CDS 100% 4.050 5.670 N EAF1 n/a
4 TRCN0000156773 GCCCTGGTCTAAGTTACTCAA pLKO.1 1125 3UTR 100% 4.950 3.960 N EAF1 n/a
5 TRCN0000154484 GCATCTATAGACACTTCCTGT pLKO.1 283 5UTR 100% 2.640 2.112 N EAF1 n/a
6 TRCN0000428306 TGAGGGCTGAAGTTGACATTA pLKO_005 558 CDS 100% 13.200 9.240 N EAF1 n/a
7 TRCN0000155130 CCCTGGTCTAAGTTACTCAAA pLKO.1 1126 3UTR 100% 4.950 3.465 N EAF1 n/a
8 TRCN0000154620 GAACACCCTCAGAAATGACTT pLKO.1 778 CDS 100% 4.950 3.465 N EAF1 n/a
9 TRCN0000430972 AGTGCTGGATCTTTCGAAACC pLKO_005 834 CDS 100% 4.050 2.835 N EAF1 n/a
10 TRCN0000157342 CCCTCAGAAATGACTTGCAGT pLKO.1 783 CDS 100% 2.640 1.848 N EAF1 n/a
11 TRCN0000435898 ACCAGCAGCCCTACAACAGTA pLKO_005 705 CDS 100% 4.950 2.970 N EAF1 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3255 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09260 pDONR223 100% 62% 58.2% None (many diffs) n/a
2 ccsbBroad304_09260 pLX_304 0% 62% 58.2% V5 (many diffs) n/a
3 TRCN0000465330 CGATGGGTATCCCTGACTGTTAGA pLX_317 47.3% 62% 58.2% V5 (many diffs) n/a
Download CSV