Construct: ORF TRCN0000465344
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002496.1_s317c1
- Derived from:
- ccsbBroadEn_03230
- DNA Barcode:
- GCCTTGGGAGACATTCGGCGACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- JPT1 (51155)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465344
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_016185.4 | 100% | 100% | |
| 2 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_001002032.3 | 78.8% | 57.8% | 296_297insGGGAGAAGGTGATATTCAT;444_543del |
| 3 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_001288611.2 | 76.3% | 68.3% | 317_320delGTAA;360_361ins106 |
| 4 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_001002033.3 | 70.1% | 70.1% | 0_1ins138 |
| 5 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_001288609.1 | 70.1% | 70.1% | 0_1ins138 |
| 6 | human | 51155 | JPT1 | Jupiter microtubule associa... | NM_001288610.1 | 70.1% | 70.1% | 0_1ins138 |
| 7 | human | 51155 | JPT1 | Jupiter microtubule associa... | XM_024450779.1 | 70.1% | 70.1% | 0_1ins138 |
| 8 | human | 51155 | JPT1 | Jupiter microtubule associa... | NR_109933.2 | 31.4% | 1_115del;411_446del;614_1470del | |
| 9 | mouse | 15374 | Jpt1 | Jupiter microtubule associa... | NM_008258.1 | 88% | 90.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 528
- ORF length:
- 462
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cacaaccacc accttcaagg gagtcgaccc caacagcagg aatagctccc 121 gagttttgcg gcctccaggt ggtggatcca atttttcatt aggttttgat gaaccaacag 181 aacaacctgt gaggaagaac aaaatggcct ctaatatctt tgggacacct gaagaaaatc 241 aagcttcttg ggccaagtca gcaggtgcca agtctagtgg tggcagggaa gacttGGAGT 301 CATCTGGACT GCAGAGAAGG AACTCCTCTG AAGCAAGCTC CGGAGACTTC TTAGATCTGA 361 AGGGAGAAGG TGATATTCAT GAAAATGTGG ACACAGACTT GCCAGGCAGC CTGGGGCAGA 421 GTGAAGAGAA GCCCGTGCCT GCTGCGCCTG TGCCCAGCCC GGTGGCCCCG GCCCCAGTGC 481 CATCCAGAAG AAATCCCCCT GGCGGCAAGT CCAGCCTCGT CTTGGGTTAC CCAACTTTCT 541 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 601 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 661 GTGGAAAGGA CGAGCCTTGG GAGACATTCG GCGACTCACG CGTTAAGTCg acaatcaacc 721 tctggattac aaaatttgtg aaagatt