Transcript: Mouse NM_008258.1

Mus musculus Jupiter microtubule associated homolog 1 (Jpt1), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Jpt1 (15374)
Length:
1384
CDS:
96..560

Additional Resources:

NCBI RefSeq record:
NM_008258.1
NBCI Gene record:
Jpt1 (15374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336277 TGCCATGTGGAGTGATCAAAC pLKO_005 994 3UTR 100% 10.800 7.560 N Jpt1 n/a
2 TRCN0000194141 GAGAAGGTGATATGCATGAAA pLKO.1 394 CDS 100% 5.625 3.938 N Jpt1 n/a
3 TRCN0000336276 GAGAAGGTGATATGCATGAAA pLKO_005 394 CDS 100% 5.625 3.938 N Jpt1 n/a
4 TRCN0000176148 GAAGTAACTCTTCTGAAGCAA pLKO.1 346 CDS 100% 3.000 2.100 N Jpt1 n/a
5 TRCN0000336218 GAAGTAACTCTTCTGAAGCAA pLKO_005 346 CDS 100% 3.000 2.100 N Jpt1 n/a
6 TRCN0000175425 CAAGATGGCTTCTAACATCTT pLKO.1 230 CDS 100% 0.495 0.347 N Jpt1 n/a
7 TRCN0000336274 CAAGATGGCTTCTAACATCTT pLKO_005 230 CDS 100% 0.495 0.347 N Jpt1 n/a
8 TRCN0000193650 CAGAGAAGTAACTCTTCTGAA pLKO.1 342 CDS 100% 0.495 0.347 N Jpt1 n/a
9 TRCN0000176004 GAAGAACAAGATGGCTTCTAA pLKO.1 224 CDS 100% 5.625 3.375 N Jpt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03230 pDONR223 100% 88% 90.2% None (many diffs) n/a
2 ccsbBroad304_03230 pLX_304 0% 88% 90.2% V5 (many diffs) n/a
3 TRCN0000465344 GCCTTGGGAGACATTCGGCGACTC pLX_317 50.4% 88% 90.2% V5 (many diffs) n/a
Download CSV