Construct: ORF TRCN0000465366
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013241.2_s317c1
- Derived from:
- ccsbBroadEn_15090
- DNA Barcode:
- CATTCTTCTTCGGCTCAAGACAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ETNK2 (55224)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465366
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55224 | ETNK2 | ethanolamine kinase 2 | NM_018208.4 | 100% | 100% | |
2 | human | 55224 | ETNK2 | ethanolamine kinase 2 | NM_001297762.2 | 89.3% | 89.3% | 515_516ins123 |
3 | human | 55224 | ETNK2 | ethanolamine kinase 2 | NM_001297760.2 | 85.1% | 86.3% | 1014_1119del;1182_1183ins82 |
4 | human | 55224 | ETNK2 | ethanolamine kinase 2 | XM_024448127.1 | 60.4% | 60.6% | 0_1ins312;702_807del;870_871ins82 |
5 | human | 55224 | ETNK2 | ethanolamine kinase 2 | NM_001297761.2 | 53.8% | 53.8% | 0_1ins534 |
6 | human | 55224 | ETNK2 | ethanolamine kinase 2 | XM_011509714.2 | 42.8% | 42.3% | 0_1ins534;480_585del;648_649ins82 |
7 | human | 55224 | ETNK2 | ethanolamine kinase 2 | XM_011509715.2 | 42.8% | 42.3% | 0_1ins534;480_585del;648_649ins82 |
8 | human | 55224 | ETNK2 | ethanolamine kinase 2 | XM_017001632.1 | 42.8% | 42.3% | 0_1ins534;480_585del;648_649ins82 |
9 | mouse | 214253 | Etnk2 | ethanolamine kinase 2 | NM_175443.5 | 86.4% | 87.3% | (many diffs) |
10 | mouse | 214253 | Etnk2 | ethanolamine kinase 2 | XM_006529364.2 | 80% | 80.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1224
- ORF length:
- 1158
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tgtgccccct tcggcccctc agccgcgcgc gtcctttcac ctgaggaggc 121 acacgccttg cccgcagtgc tcatggggca tggaggagaa ggcggcggcc agcgccagct 181 gccgggagcc gccgggcccc ccgagggccg ccgccgtcgc gtacttcggc atttccgtgg 241 acccggacga catccttccc ggggccctgc gcctcatcca ggagctgcgg ccgcattgga 301 aacccgagca agttcggacc aagcgcttca cggatggcat caccaacaag ctggtggcct 361 gctatgtgga ggaggacatg caggactgcg tgctggtccg ggtgtatggg gagcggacgg 421 agctgctggt ggaccgggag aatgaggtca gaaacttcca gctgctgcga gcacacagct 481 gtgcccccaa actctactgc accttccaga atgggctgtg ctatgagtac atgcagggtg 541 tggccctgga gcctgagcac atccgtgagc cccggctttt caggttaatc gccttagaaa 601 tggcaaagat tcatactatc cacgccaacg gcagcctgcc caagcccatc ctctggcaca 661 agatgcacaa ttatttcacg cttgtgaaga acgagatcaa ccccagcctt tctgcagatg 721 tccctaaggt agaggtgttg gaacgggagc tggcctggct gaaggagcat ctgtcccagc 781 tggagtcccc tgtggtgttt tgtcacaatg acctgctctg caagaatatc atctatgaca 841 gcatcaaagg tcacgtgcgg ttcattgact atgaatatgc tggctacaac taccaagctt 901 ttgacattgg caacCATTTC AATGAGTTTG CAGGCGTGAA TGAGGTGGAT TACTGCCTGT 961 ACCCGGCGCG GGAGACCCAG CTGCAGTGGC TGCACTACTA CCTGCAGGCA CAAAAGGGGA 1021 TGGCCGTGAC CCCCAGGGAG GTGCAAAGGC TCTACGTGCA AGTCAACAAG TTTGCCCTGG 1081 CGTCTCACTT CTTCTGGGCT CTCTGGGCCC TCATCCAGAA CCAGTACTCC ACCATCGACT 1141 TTGATTTCCT CAGGTACGCA GTGATCCGAT TCAACCAGTA CTTCAAGGTG AAGCCTCAAG 1201 CGTCAGCCTT GGAGATGCCA AAGTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1261 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1321 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC ATTCTTCTTC 1381 GGCTCAAGAC AAAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1441 att