Transcript: Human XM_011509714.2

PREDICTED: Homo sapiens ethanolamine kinase 2 (ETNK2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETNK2 (55224)
Length:
1959
CDS:
105..755

Additional Resources:

NCBI RefSeq record:
XM_011509714.2
NBCI Gene record:
ETNK2 (55224)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379685 ACGTGCAAGTCAACAAGTTTG pLKO_005 559 CDS 100% 10.800 15.120 N ETNK2 n/a
2 TRCN0000236042 ACGTGCGGTTCATTGACTATG pLKO_005 358 CDS 100% 10.800 15.120 N ETNK2 n/a
3 TRCN0000236045 AGTACTCCACCATCGACTTTG pLKO_005 734 CDS 100% 10.800 15.120 N ETNK2 n/a
4 TRCN0000380813 TCTGCAAGAATATCATCTATG pLKO_005 322 CDS 100% 10.800 15.120 N ETNK2 n/a
5 TRCN0000195403 CACATGGATGTACCTATCTTG pLKO.1 1318 3UTR 100% 4.950 6.930 N ETNK2 n/a
6 TRCN0000195358 CGCTTGTGAAGAACGAGATCA pLKO.1 184 CDS 100% 4.950 6.930 N ETNK2 n/a
7 TRCN0000195633 CTACGTGCAAGTCAACAAGTT pLKO.1 557 CDS 100% 4.950 6.930 N ETNK2 n/a
8 TRCN0000196565 GCACAATTATTTCACGCTTGT pLKO.1 170 CDS 100% 4.050 5.670 N ETNK2 n/a
9 TRCN0000244246 TGGCACAAGATGCACAATTAT pLKO_005 159 CDS 100% 15.000 10.500 N ETNK2 n/a
10 TRCN0000052576 CTGGCACAAGATGCACAATTA pLKO.1 158 CDS 100% 13.200 9.240 N ETNK2 n/a
11 TRCN0000236043 ATGAGTTTGCAGGCGTGAATG pLKO_005 427 CDS 100% 10.800 7.560 N ETNK2 n/a
12 TRCN0000236044 TCAGAAAGGTGCTGACTAAAC pLKO_005 1800 3UTR 100% 10.800 7.560 N ETNK2 n/a
13 TRCN0000052574 CGCCTTAGAAATGGCAAAGAT pLKO.1 95 5UTR 100% 5.625 3.938 N ETNK2 n/a
14 TRCN0000197221 GCGTGAATGAGGTGGATTACT pLKO.1 439 CDS 100% 5.625 3.938 N ETNK2 n/a
15 TRCN0000195577 CCATCAGAAAGGTGCTGACTA pLKO.1 1797 3UTR 100% 4.950 3.465 N ETNK2 n/a
16 TRCN0000052575 CCAGTGCTGTAGAGTCGGAAA pLKO.1 623 CDS 100% 4.050 2.835 N ETNK2 n/a
17 TRCN0000052573 GCGGTTCATTGACTATGAATA pLKO.1 362 CDS 100% 1.320 0.924 N ETNK2 n/a
18 TRCN0000174230 GCGGTTCATTGACTATGAATA pLKO.1 362 CDS 100% 1.320 0.924 N ETNK2 n/a
19 TRCN0000381637 CCTGTTCTCCAGAGCTCAATT pLKO_005 879 3UTR 100% 13.200 7.920 N ETNK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03553 pDONR223 100% 42.8% 42.3% None 0_1ins534;480_585del;648_649ins82 n/a
2 ccsbBroad304_03553 pLX_304 0% 42.8% 42.3% V5 0_1ins534;480_585del;648_649ins82 n/a
3 TRCN0000491659 GAAGTCACCAAGTGTTCGATTCTC pLX_317 34% 42.8% 42.3% V5 0_1ins534;480_585del;648_649ins82 n/a
4 ccsbBroadEn_15090 pDONR223 0% 42.8% 42.3% None 0_1ins534;480_585del;648_649ins82 n/a
5 ccsbBroad304_15090 pLX_304 0% 42.8% 42.3% V5 0_1ins534;480_585del;648_649ins82 n/a
6 TRCN0000465366 CATTCTTCTTCGGCTCAAGACAAA pLX_317 27.1% 42.8% 42.3% V5 0_1ins534;480_585del;648_649ins82 n/a
Download CSV