Transcript: Mouse XM_006529364.2

PREDICTED: Mus musculus ethanolamine kinase 2 (Etnk2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Etnk2 (214253)
Length:
2277
CDS:
275..1348

Additional Resources:

NCBI RefSeq record:
XM_006529364.2
NBCI Gene record:
Etnk2 (214253)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378445 GGTGCAGTGGCTGCGTTATTA pLKO_005 1102 CDS 100% 15.000 21.000 N Etnk2 n/a
2 TRCN0000024795 CGCCTTAGAAATGGCTAAGAT pLKO.1 796 CDS 100% 0.563 0.788 N Etnk2 n/a
3 TRCN0000362048 ACTCATACAGAACCAGTATTC pLKO_005 1231 CDS 100% 10.800 8.640 N Etnk2 n/a
4 TRCN0000024794 CGGCATCACCAACAAGCTATT pLKO.1 541 CDS 100% 10.800 8.640 N Etnk2 n/a
5 TRCN0000362056 ATTCGCTCTGGCATCTCATTT pLKO_005 1192 CDS 100% 13.200 9.240 N Etnk2 n/a
6 TRCN0000024797 TGATCTACTCTGCAAGAATAT pLKO.1 1015 CDS 100% 13.200 9.240 N Etnk2 n/a
7 TRCN0000380813 TCTGCAAGAATATCATCTATG pLKO_005 1023 CDS 100% 10.800 7.560 N ETNK2 n/a
8 TRCN0000024798 GTGGTGTTCTGTCACAATGAT pLKO.1 998 CDS 100% 5.625 3.938 N Etnk2 n/a
9 TRCN0000024796 CCCAAACTCTACTGTACCTTT pLKO.1 692 CDS 100% 4.950 3.465 N Etnk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03553 pDONR223 100% 80% 80.5% None (many diffs) n/a
2 ccsbBroad304_03553 pLX_304 0% 80% 80.5% V5 (many diffs) n/a
3 TRCN0000491659 GAAGTCACCAAGTGTTCGATTCTC pLX_317 34% 80% 80.5% V5 (many diffs) n/a
4 ccsbBroadEn_15090 pDONR223 0% 80% 80.5% None (many diffs) n/a
5 ccsbBroad304_15090 pLX_304 0% 80% 80.5% V5 (many diffs) n/a
6 TRCN0000465366 CATTCTTCTTCGGCTCAAGACAAA pLX_317 27.1% 80% 80.5% V5 (many diffs) n/a
Download CSV