Construct: ORF TRCN0000465404
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015807.1_s317c1
- Derived from:
- ccsbBroadEn_08948
- DNA Barcode:
- TCGGGACTCCCCCGGGGGTGGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OGFOD3 (79701)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465404
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | NM_175902.5 | 99.8% | 99.6% | 815C>G |
2 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | NM_024648.3 | 86.9% | 81.5% | (many diffs) |
3 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | XR_430034.4 | 49.5% | 1_152del;967C>G;1146_2001del | |
4 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | XR_933942.3 | 48.2% | 1_152del;967C>G;1146_2055del | |
5 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | XR_001752626.2 | 45.9% | 1_152del;967C>G;1146_2157del | |
6 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | XR_002958069.1 | 39.3% | 1_152del;967C>G;1146_2521del | |
7 | human | 79701 | OGFOD3 | 2-oxoglutarate and iron dep... | NR_033265.2 | 22% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1059
- ORF length:
- 993
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcctcagcgg agggccgcaa ccaaggcgcc cgagggcaac ggagcggccg 121 agcgccggaa ccggagcagc accaagaagg accgagcccc gcgggaggtg cagaggctgt 181 ggcagaggcc gtggctaagg accgcgggcc tgggggctgg ctttgtgctc accgcactcc 241 tgctctggag cagcttgggg gccgacgacg gggtcgcaga ggtcctggcc cgccgtggcg 301 aggtcgtggc agggagattc atcgaggtgc cctgctctga ggactacgac agtcaccgca 361 ggttcgaagg ctgcactccc cgaaagtgcg gcagaggtgt caccgatgtc gtcatcacca 421 gggaggaagc ggagcggatt cgcagcgtag ctgaaaaggg gctctccctg ggaggatctg 481 acggaggggc atccattctg gacttgcact caggggccct gtctgtcggg aagcactttg 541 tgaacctgta cagatacttc ggggataaaa tacagaacat cttctcagag gaggacttcc 601 ggttataccg ggaggtgcgg cagaaggtcc agctcaccat tgctgaggct tttggcatca 661 gcgcatcctc gctgcatctg accaagccca ccttcttctc ccgcataaac agcacggaag 721 cgcggacggc gcacgacgag tactggcatg cgcacgtgga caaggtgacc TACGGCTCCT 781 TCGACTACAC CTCGCTGCTG TACCTCTCCA ACTACCTGGA GGACTTCGGC GGAGGGCGGT 841 TCATGTTCAT GGAGGAGGGT GCCAACAAGA CGGTGGAGCG GAGAGCTGGA TGTTTTTGTT 901 TCCGGATGAT GTCTTGTGGG TTCCAAGAAG TTAATGGACC GAGAGCCAGT GAAGCTGCTG 961 GTGCGAAGGC TGGAGTCAGG TGTCCTCCGG GGACTCACCA CCCGCCCGAG AGGGGAGAGA 1021 CACATGCGAT TCTGGAAGCT GAGAGCATTG CTTATTGTTG CCCAACTTTC TTGTACAAAG 1081 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1141 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1201 ACGATCGGGA CTCCCCCGGG GGTGGAACAC GCGTTAAGTC gacaatcaac ctctggatta 1261 caaaatttgt gaaagatt