Construct: ORF TRCN0000465470
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010477.1_s317c1
- Derived from:
- ccsbBroadEn_14267
- DNA Barcode:
- ACTCTTCGTACTGGACCCTGATAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZYG11B (79699)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465470
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79699 | ZYG11B | zyg-11 family member B, cel... | XM_006710898.4 | 52.5% | 52.5% | (many diffs) |
| 2 | human | 79699 | ZYG11B | zyg-11 family member B, cel... | NM_024646.3 | 52.2% | 52.2% | (many diffs) |
| 3 | human | 79699 | ZYG11B | zyg-11 family member B, cel... | XM_017002336.2 | 28.3% | 28.3% | (many diffs) |
| 4 | mouse | 414872 | Zyg11b | zyg-ll family member B, cel... | XM_006503213.3 | 53.8% | 57.6% | (many diffs) |
| 5 | mouse | 414872 | Zyg11b | zyg-ll family member B, cel... | NM_001033634.3 | 48% | 51.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1236
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga aaaaacaaaa ccagaaattt taaagcttgt ggttactggg atgagaaacc 121 accctatgaa tttgccagtg caactggctg caagcgcctg tgtatttaac ttaaccaagc 181 aggatcttgc tgcaggaatg cctgtccgac tcctggctga tgtgacccat ttgctgctca 241 aagccatgga acattttccc aatcaccagc agttacagaa gaattgcctc ctttcacttt 301 gcagtgaccg gatccttcaa gatgttccat ttaacaggtt tgaagcagcc aagcttgtca 361 tgcagtggct ttgcaaccat gaggatcaaa acatgcaaag gatggcagtt gctatcattt 421 ctatcctggc tgccaagctt tctacagaac aaactgcaca gcttggtact gagctcttca 481 ttgtcaggca acttcttcaa atagtgaagc agaaaaccaa tcaaaattca gtggacacta 541 cattgaaatt tactttgagt gcactttgga acctcacaga tgaatctcca accacttgta 601 gacactttat tgaaaaccaa gggttagaac tcttcatgag ggttctagag tctttcccaa 661 ctgagtcatc cattcagcag aaagttctag gacttttgaa caatatagct gaagtacaag 721 aattacattc tgaattaatg tggaaagatt ttatagacca catcagtagt ctcctacaca 781 gtgtggaagt ggaagtcagt tactttgcag ctggaattat tgcccattta atatccagag 841 gtgaacaagc ttggacattg agtcgtagcc agaggaattc tctgctggat gatttgcatt 901 cagctatttt gaaatggcca actccagagt gtgggatggt agcatacagg tcctttaatc 961 catttttccc attacttggc tgtttcacaa caccaggagt tcagctatgg gcagtttggg 1021 ccatgcaaca tgtctgcagc aagaatcctt caaggtattg cagcatgctg attgaagaag 1081 gaggattgca gcatttatac aacatcaaag atcatgaaca tactgatccc catgtccaac 1141 agattgctgt ggccattctG GATAGCTTAG AAAAACACAT TGTGCGCCAT GGGAGGCCAC 1201 CTCCCTGTAA AAAACAGCCC CAAGCCAGAC TAAATTGCCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 AACTCTTCGT ACTGGACCCT GATATACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt