Transcript: Mouse NM_001033634.3

Mus musculus zyg-ll family member B, cell cycle regulator (Zyg11b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Zyg11b (414872)
Length:
10654
CDS:
171..2405

Additional Resources:

NCBI RefSeq record:
NM_001033634.3
NBCI Gene record:
Zyg11b (414872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033634.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267629 GGTAACCAGATGCGCCTAAAG pLKO_005 402 CDS 100% 10.800 15.120 N Zyg11b n/a
2 TRCN0000267628 GTGTATCTGTCAGGCATAAAT pLKO_005 3189 3UTR 100% 15.000 10.500 N Zyg11b n/a
3 TRCN0000256706 CGAGCTCTGAGCATCACTAAT pLKO_005 663 CDS 100% 13.200 9.240 N Zyg11b n/a
4 TRCN0000256705 GCATGGCCGTGGCTATCATTT pLKO_005 1567 CDS 100% 13.200 9.240 N Zyg11b n/a
5 TRCN0000256707 ACCGGCTTCTTCAGACTATAG pLKO_005 337 CDS 100% 10.800 7.560 N Zyg11b n/a
6 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 10554 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 10339 3UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 9277 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033634.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14267 pDONR223 100% 48% 51.4% None (many diffs) n/a
2 ccsbBroad304_14267 pLX_304 0% 48% 51.4% V5 (many diffs) n/a
3 TRCN0000465470 ACTCTTCGTACTGGACCCTGATAT pLX_317 7.3% 48% 51.4% V5 (many diffs) n/a
Download CSV