Transcript: Human XM_006710898.4

PREDICTED: Homo sapiens zyg-11 family member B, cell cycle regulator (ZYG11B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZYG11B (79699)
Length:
7677
CDS:
95..2317

Additional Resources:

NCBI RefSeq record:
XM_006710898.4
NBCI Gene record:
ZYG11B (79699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006710898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246306 GATTAGAGAGCTTGGATATTT pLKO_005 642 CDS 100% 15.000 21.000 N ZYG11B n/a
2 TRCN0000257515 GGCAACCAGATGCGCTTAAAG pLKO_005 314 CDS 100% 13.200 18.480 N ZYG11B n/a
3 TRCN0000257504 GGATGGCAGTTGCTATCATTT pLKO_005 1479 CDS 100% 13.200 10.560 N ZYG11B n/a
4 TRCN0000246308 GAAGCTTGTCCTCCATATTTA pLKO_005 2988 3UTR 100% 15.000 10.500 N ZYG11B n/a
5 TRCN0000246307 AGACTAAATTGATAGCCATAA pLKO_005 2306 CDS 100% 10.800 7.560 N ZYG11B n/a
6 TRCN0000168076 CGAGCTTTAAGCATCACGAAT pLKO.1 575 CDS 100% 4.950 3.465 N ZYG11B n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5066 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5067 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5231 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006710898.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14267 pDONR223 100% 52.5% 52.5% None (many diffs) n/a
2 ccsbBroad304_14267 pLX_304 0% 52.5% 52.5% V5 (many diffs) n/a
3 TRCN0000465470 ACTCTTCGTACTGGACCCTGATAT pLX_317 7.3% 52.5% 52.5% V5 (many diffs) n/a
Download CSV