Construct: ORF TRCN0000465473
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013972.1_s317c1
- Derived from:
- ccsbBroadEn_08441
- DNA Barcode:
- CCCTCCAGGCTGTGCGCTCCAAGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HCFC1R1 (54985)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465473
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001002017.2 | 99.7% | 99.1% | 218C>A |
| 2 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001288666.1 | 99.7% | 99.1% | 218C>A |
| 3 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001288667.1 | 87.2% | 86.7% | 92_142del;269C>A |
| 4 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | XM_017023384.1 | 87.2% | 86.7% | 92_142del;269C>A |
| 5 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001002018.2 | 85.9% | 84.7% | 96_152del;275C>A |
| 6 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001288665.1 | 85.9% | 84.7% | 96_152del;275C>A |
| 7 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_017885.4 | 85.9% | 84.7% | 96_152del;275C>A |
| 8 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001308070.1 | 80.6% | 73.9% | (many diffs) |
| 9 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | NM_001288668.1 | 62.7% | 62.1% | 0_1ins132;86C>A |
| 10 | human | 54985 | HCFC1R1 | host cell factor C1 regulat... | XM_011522559.3 | 62.7% | 62.1% | 0_1ins132;86C>A |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 423
- ORF length:
- 357
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat cctgcagcag cccttgcagc gaggccccca gggaggggcc cagcgcctcc 121 cgcgggccgc cttgggggtg acttggggcc tggacgccag ggagcctctg cgcaagcagt 181 ttctgtctga ggagaacatg gccacccact tctctcaact cagcctgcac aatgaccacc 241 cctactgcag cccccccatg accttctccc cagccctgcc ccaactcagg agcccttgct 301 ctgagctgct tctctggcgc tatcctggca gcctcatccc tgaggccctc cgtctgctga 361 ggcTGGGGGA CACCCCCAGT CCCCCCTACC CTGCAACCCC AGCTGGGGAC ATAATGGAGC 421 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 481 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 541 GGCTTTATAT ATCTTGTGGA AAGGACGACC CTCCAGGCTG TGCGCTCCAA GGACGCGTTA 601 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt