Transcript: Human NM_001308070.1

Homo sapiens host cell factor C1 regulator 1 (HCFC1R1), transcript variant 8, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
HCFC1R1 (54985)
Length:
689
CDS:
132..428

Additional Resources:

NCBI RefSeq record:
NM_001308070.1
NBCI Gene record:
HCFC1R1 (54985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242882 TCTGCGCAAGCAGTTTCTGTC pLKO_005 170 CDS 100% 4.050 3.240 N HCFC1R1 n/a
2 TRCN0000242880 GACATAATGGAGCTCTGAGTG pLKO_005 411 CDS 100% 4.050 2.835 N HCFC1R1 n/a
3 TRCN0000242879 TTGCTCTGAGCTGCTTCTCTG pLKO_005 299 CDS 100% 4.050 2.835 N HCFC1R1 n/a
4 TRCN0000242881 ACAACAGAAGAGACCAGCGAC pLKO_005 469 3UTR 100% 2.160 1.512 N HCFC1R1 n/a
5 TRCN0000242883 CTCAACTCAGCCTGCACAATG pLKO_005 217 CDS 100% 10.800 6.480 N HCFC1R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08441 pDONR223 100% 80.6% 73.9% None (many diffs) n/a
2 ccsbBroad304_08441 pLX_304 0% 80.6% 73.9% V5 (many diffs) n/a
3 TRCN0000465473 CCCTCCAGGCTGTGCGCTCCAAGG pLX_317 18.5% 80.6% 73.9% V5 (many diffs) n/a
Download CSV