Construct: ORF TRCN0000465508
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006596.1_s317c1
- Derived from:
- ccsbBroadEn_06043
- DNA Barcode:
- AGACACAACGTTAATAATACAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CRYBA4 (1413)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465508
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1413 | CRYBA4 | crystallin beta A4 | NM_001886.3 | 99.8% | 100% | 171T>C |
| 2 | human | 1413 | CRYBA4 | crystallin beta A4 | XM_006724140.3 | 97.3% | 97.5% | 1_15del;186T>C |
| 3 | human | 1413 | CRYBA4 | crystallin beta A4 | XM_017028598.1 | 94.5% | 94.6% | 1_33del;204T>C |
| 4 | mouse | 12959 | Cryba4 | crystallin, beta A4 | NM_021351.2 | 85.3% | 91.8% | (many diffs) |
| 5 | mouse | 12959 | Cryba4 | crystallin, beta A4 | NM_001312884.1 | 79.5% | 86.2% | (many diffs) |
| 6 | mouse | 12959 | Cryba4 | crystallin, beta A4 | XM_006534749.3 | 74.3% | 80% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 654
- ORF length:
- 588
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cctgcaatgc acaaagtcag cgggaccctg gaagatggtg gtgtgggatg 121 aggacggctt ccagggccgg cggcacgagt tcacggccga gtgccccagc gtgctggagc 181 ttggcttcga gactgtgcga tctttgaaag tgctgagtgg agcgtgggtg ggcttcgagc 241 atgctggctt ccaagggcag cagtacattc tggaacgagg cgaatatcca agctgggatg 301 cctggggcgg caacacggcc taccccgccg agaggctcac ctccttccgg ccTGCGGCCT 361 GTGCTAACCA CCGTGACTCG AGGCTGACAA TCTTCGAGCA AGAGAACTTC CTGGGCAAGA 421 AAGGAGAGCT GAGCGATGAC TATCCTTCCC TCCAGGCCAT GGGATGGGAA GGCAATGAAG 481 TAGGGTCCTT CCACGTCCAC TCTGGGGCCT GGGTTTGCTC CCAGTTTCCG GGCTACCGAG 541 GATTTCAGTA TGTGCTGGAA TGCGATCACC ATTCCGGTGA CTACAAACAT TTCCGGGAGT 601 GGGGCTCTCA TGCCCCGACC TTCCAGGTGC AGAGCATCCG CAGGATCCAG CAGTGCCCAA 661 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 721 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 781 TATCTTGTGG AAAGGACGAA GACACAACGT TAATAATACA ATTACGCGTT AAGTCgacaa 841 tcaacctctg gattacaaaa tttgtgaaag att