Transcript: Mouse NM_021351.2

Mus musculus crystallin, beta A4 (Cryba4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cryba4 (12959)
Length:
819
CDS:
40..630

Additional Resources:

NCBI RefSeq record:
NM_021351.2
NBCI Gene record:
Cryba4 (12959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098192 CCGCGACTCAAGGCTGACCAT pLKO.1 345 CDS 100% 0.000 0.000 N Cryba4 n/a
2 TRCN0000098190 GCGTGGGTTTGTTCCCAGTTT pLKO.1 481 CDS 100% 4.950 3.465 N Cryba4 n/a
3 TRCN0000098191 CTCAGGTGACTACAAGCACTT pLKO.1 546 CDS 100% 4.050 2.835 N Cryba4 n/a
4 TRCN0000098193 AGGACAGCAATATGTGCTGGA pLKO.1 228 CDS 100% 0.216 0.151 N Cryba4 n/a
5 TRCN0000098194 ACGGCATGAATTCACAGCTGA pLKO.1 114 CDS 100% 0.000 0.000 N Cryba4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06043 pDONR223 100% 85.3% 91.8% None (many diffs) n/a
2 ccsbBroad304_06043 pLX_304 0% 85.3% 91.8% V5 (many diffs) n/a
3 TRCN0000465508 AGACACAACGTTAATAATACAATT pLX_317 51.3% 85.3% 91.8% V5 (many diffs) n/a
Download CSV