Transcript: Human XM_006724140.3

PREDICTED: Homo sapiens crystallin beta A4 (CRYBA4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRYBA4 (1413)
Length:
869
CDS:
79..684

Additional Resources:

NCBI RefSeq record:
XM_006724140.3
NBCI Gene record:
CRYBA4 (1413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156335 CAATGAAGTAGGGTCCTTCCA pLKO.1 501 CDS 100% 2.640 3.696 N CRYBA4 n/a
2 TRCN0000153858 CATTCCGGTGACTACAAACAT pLKO.1 598 CDS 100% 5.625 3.938 N CRYBA4 n/a
3 TRCN0000156452 CTTCGAGACTGTGCGATCTTT pLKO.1 213 CDS 100% 5.625 3.938 N CRYBA4 n/a
4 TRCN0000153111 GACTGTGCGATCTTTGAAAGT pLKO.1 219 CDS 100% 4.950 3.465 N CRYBA4 n/a
5 TRCN0000157829 CAGTATGTGCTGGAATGCGAT pLKO.1 574 CDS 100% 2.640 1.848 N CRYBA4 n/a
6 TRCN0000157722 CCGAGGATTTCAGTATGTGCT pLKO.1 564 CDS 100% 2.640 1.848 N CRYBA4 n/a
7 TRCN0000154150 CGATCTTTGAAAGTGCTGAGT pLKO.1 226 CDS 100% 2.640 1.848 N CRYBA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724140.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06043 pDONR223 100% 97.3% 97.5% None 1_15del;186T>C n/a
2 ccsbBroad304_06043 pLX_304 0% 97.3% 97.5% V5 1_15del;186T>C n/a
3 TRCN0000465508 AGACACAACGTTAATAATACAATT pLX_317 51.3% 97.3% 97.5% V5 1_15del;186T>C n/a
Download CSV