Construct: ORF TRCN0000465577
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008163.1_s317c1
- Derived from:
- ccsbBroadEn_09942
- DNA Barcode:
- TAGCCTGACCTATTGACCCCCAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MORN3 (283385)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465577
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 283385 | MORN3 | MORN repeat containing 3 | NM_001363685.2 | 99.8% | 99.5% | 127A>G |
| 2 | human | 283385 | MORN3 | MORN repeat containing 3 | NM_173855.5 | 99.8% | 99.5% | 127A>G |
| 3 | human | 283385 | MORN3 | MORN repeat containing 3 | XM_011538213.2 | 99.8% | 99.5% | 127A>G |
| 4 | human | 283385 | MORN3 | MORN repeat containing 3 | XM_011538214.3 | 51.9% | 51.6% | 127A>G;302_303ins345 |
| 5 | human | 283385 | MORN3 | MORN repeat containing 3 | XR_242999.4 | 39.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 786
- ORF length:
- 720
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agtctctaag tgcccaaaaa agtcggagtc cctgtggaag gggtgggacc 121 ggaaggccca gaggaacggc ctgcggagcc aggtatacgc tgtgaatggc gactactatg 181 tgggcgagtg ggaggacaac gtgaaacacg ggaaaggaac acaggtctgg aagaagaaag 241 gagccatcta tgagggggac tggaagtttg ggaagcgaga cggctacggc accctcagcc 301 ttcctgacca acagacagga aagtgcagga gagtctactc aggctggtgg aaaggtgata 361 agaaatcggg ttatgggatc cagttttTCG GACCCAAGGA GTATTATGAG GGTGACTGGT 421 GTGGCAGCCA GCGCAGCGGG TGGGGCCGCA TGTATTACAG CAACGGCGAC ATCTACGAGG 481 GACAGTGGGA GAACGACAAG CCCAACGGGG AGGGCATGCT GCGCCTGAAG AACGGGAACC 541 GCTACGAGGG CTGCTGGGAG AGAGGCATGA AGAACGGGGC GGGGCGTTTC TTCCATCTGG 601 ACCACGGCCA GCTGTTTGAA GGCTTCTGGG TGGACAATAT GGCCAAATGC GGGACGATGA 661 TCGACTTTGG CCGTGACGAG GCCCCTGAGC CCACTCAGTT CCCCATTCCT GAGGTCAAAA 721 TCCTAGACCC TGATGGTGTG CTGGCGGAGG CCTTGGCCAT GTTCAGGAAG ACAGAGGAAG 781 GAGATTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 841 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 901 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATAGCCTGAC CTATTGACCC CCAATACGCG 961 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt