Transcript: Human XR_242999.4

PREDICTED: Homo sapiens MORN repeat containing 3 (MORN3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MORN3 (283385)
Length:
1171
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_242999.4
NBCI Gene record:
MORN3 (283385)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_242999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150568 GTGATAAGAAATCGGGTTATG pLKO.1 390 3UTR 100% 10.800 15.120 N MORN3 n/a
2 TRCN0000155215 GCTGTGAATGGCGACTACTAT pLKO.1 194 3UTR 100% 5.625 7.875 N MORN3 n/a
3 TRCN0000154937 GCTGGTGGAAAGGTGATAAGA pLKO.1 378 3UTR 100% 5.625 3.938 N MORN3 n/a
4 TRCN0000154759 GAAAGTGCAGGAGAGTCTACT pLKO.1 354 3UTR 100% 4.950 3.465 N MORN3 n/a
5 TRCN0000153394 GAAGAAGAAAGGAGCCATCTA pLKO.1 265 3UTR 100% 4.950 3.465 N MORN3 n/a
6 TRCN0000154522 GACAACGTGAAACACGGGAAA pLKO.1 230 3UTR 100% 4.050 2.835 N MORN3 n/a
7 TRCN0000154356 CAGGTCTGGAAGAAGAAAGGA pLKO.1 257 3UTR 100% 3.000 2.100 N MORN3 n/a
8 TRCN0000155151 GAAACACGGGAAAGGAACACA pLKO.1 238 3UTR 100% 3.000 2.100 N MORN3 n/a
9 TRCN0000153733 CAAGGAGTATTATGAGGGTGA pLKO.1 430 3UTR 100% 2.160 1.512 N MORN3 n/a
10 TRCN0000156222 CCCAAGGAGTATTATGAGGGT pLKO.1 428 3UTR 100% 0.660 0.462 N MORN3 n/a
11 TRCN0000155026 GAGTGGAAGGACAACGTGAAA pLKO.1 221 3UTR 100% 4.950 2.970 N MORN3 n/a
12 TRCN0000363058 TTCGGACCCAAGGAGTATTAC pLKO_005 422 3UTR 100% 13.200 10.560 N Morn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_242999.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09942 pDONR223 100% 39.3% None (many diffs) n/a
2 ccsbBroad304_09942 pLX_304 0% 39.3% V5 (many diffs) n/a
3 TRCN0000465577 TAGCCTGACCTATTGACCCCCAAT pLX_317 55.2% 39.3% V5 (many diffs) n/a
Download CSV