Construct: ORF TRCN0000465582
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007322.1_s317c1
- Derived from:
- ccsbBroadEn_00047
- DNA Barcode:
- CAAAGCGCTGTATGATGGCGTGGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AKT2 (208)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465582
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001626.6 | 100% | 100% | |
2 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526614.1 | 100% | 100% | |
3 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526615.1 | 100% | 100% | |
4 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526616.1 | 100% | 100% | |
5 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526618.1 | 100% | 100% | |
6 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526619.1 | 100% | 100% | |
7 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526620.1 | 100% | 100% | |
8 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_017026470.2 | 100% | 100% | |
9 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451416.1 | 100% | 100% | |
10 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001330511.1 | 91% | 91% | 829_830ins129 |
11 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_024451417.1 | 91% | 91% | 829_830ins129 |
12 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243027.3 | 87.1% | 87.1% | 0_1ins186 |
13 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | NM_001243028.3 | 87.1% | 87.1% | 0_1ins186 |
14 | human | 208 | AKT2 | AKT serine/threonine kinase 2 | XM_011526622.2 | 82.6% | 81.7% | (many diffs) |
15 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001110208.2 | 90.5% | 98.1% | (many diffs) |
16 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331108.1 | 90.5% | 98.1% | (many diffs) |
17 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_001331109.1 | 90.5% | 98.1% | (many diffs) |
18 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | NM_007434.4 | 90.5% | 98.1% | (many diffs) |
19 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539477.1 | 90.5% | 98.1% | (many diffs) |
20 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539480.1 | 90.5% | 98.1% | (many diffs) |
21 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539481.3 | 90.5% | 98.1% | (many diffs) |
22 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539482.1 | 82.4% | 89.1% | (many diffs) |
23 | mouse | 11652 | Akt2 | thymoma viral proto-oncogene 2 | XM_006539483.1 | 82.4% | 89.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1512
- ORF length:
- 1443
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatgaggtg tctgtcatca aagaaggctg gctccacaag cgtggtgaat 121 acatcaagac ctggaggcca cggtacttcc tgctgaagag cgacggctcc ttcattgggt 181 acaaggagag gcccgaggcc cctgatcaga ctctaccccc cttaaacaac ttctccgtag 241 cagaatgcca gctgatgaag accgagaggc cgcgacccaa cacctttgtc atacgctgcc 301 tgcagtggac cacagtcatc gagaggacct tccacgtgga ttctccagac gagagggagg 361 agtggatgcg ggccatccag atggtcgcca acagcctcaa gcagcgggcc ccaggcgagg 421 accccatgga ctacaagtgt ggctccccca gtgactcctc cacgactgag gagatggaag 481 tggcggtcag caaggcacgg gctaaagtga ccatgaatga cttcgactat ctcaaactcc 541 ttggcaaggg aacctttggc aaagtcatcc tggtgcggga gaaggccact ggccgctact 601 acgccatgaa gatcctgcgg aaggaagtca tcattgccaa ggatgaagtc gctcacacag 661 tcaccgagag ccgggtcctc cagaacacca ggcacccgtt cctcactgcg ctgaagtatg 721 ccttccagac ccacgaccgc ctgtgctttg tgatggagta tgccaacggg ggtgagctgt 781 tcttccacct gtcccgggag cgtgtcttca cagaggagcg ggcccggttt tatggtgcag 841 agattgtctc ggctcttgag tacttgcact cgcgggacgt ggtataccgc gacatcaagc 901 tggaaaacct catgctggac aaagatggcc acatcaagat cactgacttt ggcctctgca 961 aagagggcat cagtgacggg gccaccatga aaaccttctg tgggaccccg gagtacctgg 1021 cgcctgaggt gctggaggac aatgactatg gccgggccgt ggactggtgg gggctgggtg 1081 tggtcatgta cgagatgatg tgcggccgcc tgcccttcta caaccaggac cacgagcgcc 1141 tcttcgagct catcctcatg gaagagatcc gcttcccgcg cacgctcagc cccgaggcca 1201 agtCCCTGCT TGCTGGGCTG CTTAAGAAGG ACCCCAAGCA GAGGCTTGGT GGGGGGCCCA 1261 GCGATGCCAA GGAGGTCATG GAGCACAGGT TCTTCCTCAG CATCAACTGG CAGGACGTGG 1321 TCCAGAAGAA GCTCCTGCCA CCCTTCAAAC CTCAGGTCAC GTCCGAGGTC GACACAAGGT 1381 ACTTCGATGA TGAATTTACC GCCCAGTCCA TCACAATCAC ACCCCCTGAC CGCTATGACA 1441 GCCTGGGCTT ACTGGAGCTG GACCAGCGGA CCCACTTCCC CCAGTTCTCC TACTCGGCCA 1501 GCATCCGCGA GTTGCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1561 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1621 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACAA AGCGCTGTAT GATGGCGTGG 1681 GACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t