Transcript: Mouse XM_006539482.1

PREDICTED: Mus musculus thymoma viral proto-oncogene 2 (Akt2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Akt2 (11652)
Length:
3037
CDS:
409..1725

Additional Resources:

NCBI RefSeq record:
XM_006539482.1
NBCI Gene record:
Akt2 (11652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022673 CGACCCAACACCTTTGTCATA pLKO.1 484 CDS 100% 4.950 6.930 N Akt2 n/a
2 TRCN0000310882 CGACCCAACACCTTTGTCATA pLKO_005 484 CDS 100% 4.950 6.930 N Akt2 n/a
3 TRCN0000265855 GACCCAACACCTTTGTCATAC pLKO_005 485 CDS 100% 10.800 7.560 N AKT2 n/a
4 TRCN0000055259 CGCCTCTTTGAGCTCATTCTT pLKO.1 1348 CDS 100% 5.625 3.938 N Akt2 n/a
5 TRCN0000301381 CGCCTCTTTGAGCTCATTCTT pLKO_005 1348 CDS 100% 5.625 3.938 N Akt2 n/a
6 TRCN0000022671 CGGGCCAAAGTGACCATGAAT pLKO.1 709 CDS 100% 5.625 3.938 N Akt2 n/a
7 TRCN0000055261 TCACTTCAGAAGTGGACACAA pLKO.1 1568 CDS 100% 4.950 3.465 N Akt2 n/a
8 TRCN0000301385 TCACTTCAGAAGTGGACACAA pLKO_005 1568 CDS 100% 4.950 3.465 N Akt2 n/a
9 TRCN0000055260 TGACCATGAATGACTTCGATT pLKO.1 719 CDS 100% 4.950 3.465 N Akt2 n/a
10 TRCN0000301309 TGACCATGAATGACTTCGATT pLKO_005 719 CDS 100% 4.950 3.465 N Akt2 n/a
11 TRCN0000022669 GCTCATTCTTATGGAGGAGAT pLKO.1 1359 CDS 100% 4.050 2.835 N Akt2 n/a
12 TRCN0000022672 GCATAGATTCTTCCTCAGCAT pLKO.1 1494 CDS 100% 2.640 1.848 N Akt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539482.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00047 pDONR223 100% 82.4% 89.1% None (many diffs) n/a
2 TRCN0000465582 CAAAGCGCTGTATGATGGCGTGGG pLX_317 21.7% 82.4% 89.1% V5 (many diffs) n/a
3 ccsbBroad304_00047 pLX_304 46.7% 79.7% 48.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488903 TTGCCCCAATCACATTTTCGGAAA pLX_317 23.4% 82.4% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489868 CTATGATACTTTATCATCGTTCTT pLX_317 12.8% 80.2% 86.6% V5 (many diffs) n/a
6 TRCN0000488553 GACATAAACATAGCTAACAAAGGT pLX_317 21.9% 80% 86.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV