Transcript: Human XM_011526614.1

PREDICTED: Homo sapiens AKT serine/threonine kinase 2 (AKT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKT2 (208)
Length:
4320
CDS:
103..1548

Additional Resources:

NCBI RefSeq record:
XM_011526614.1
NBCI Gene record:
AKT2 (208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265851 AGTCTACCCTGGTGGTCATAA pLKO_005 4021 3UTR 100% 13.200 18.480 N AKT2 n/a
2 TRCN0000009820 CAAGGTACTTCGATGATGAAT pLKO.1 1409 CDS 100% 5.625 7.875 N AKT2 n/a
3 TRCN0000255919 ACGTGGTATACCGCGACATCA pLKO_005 911 CDS 100% 4.950 6.930 N AKT2 n/a
4 TRCN0000204885 CGTAGCAGAATGCCAGCTGAT pLKO.1 270 CDS 100% 4.050 5.670 N AKT2 n/a
5 TRCN0000039970 GCAGAGATTGTCTCGGCTCTT pLKO.1 871 CDS 100% 4.050 5.670 N AKT2 n/a
6 TRCN0000174056 GCAGAGATTGTCTCGGCTCTT pLKO.1 871 CDS 100% 4.050 5.670 N AKT2 n/a
7 TRCN0000000566 CCTTAAACAACTTCTCCGTAG pLKO.1 254 CDS 100% 2.250 3.150 N AKT2 n/a
8 TRCN0000000562 CGGGCTAAAGTGACCATGAAT pLKO.1 532 CDS 100% 5.625 4.500 N AKT2 n/a
9 TRCN0000255914 AGCGTGGTGAATACATCAAGA pLKO_005 143 CDS 100% 4.950 3.960 N AKT2 n/a
10 TRCN0000009819 CATGAATGAGGTGTCTGTCAT pLKO.1 102 5UTR 100% 4.950 3.960 N AKT2 n/a
11 TRCN0000265855 GACCCAACACCTTTGTCATAC pLKO_005 308 CDS 100% 10.800 7.560 N AKT2 n/a
12 TRCN0000255918 TCCTCACTGCGCTGAAGTATG pLKO_005 734 CDS 100% 10.800 7.560 N AKT2 n/a
13 TRCN0000265848 TGCGGAAGGAAGTCATCATTG pLKO_005 650 CDS 100% 10.800 7.560 N AKT2 n/a
14 TRCN0000039968 ACAAGGTACTTCGATGATGAA pLKO.1 1408 CDS 100% 4.950 3.465 N AKT2 n/a
15 TRCN0000000565 ACGGGCTAAAGTGACCATGAA pLKO.1 531 CDS 100% 4.950 3.465 N AKT2 n/a
16 TRCN0000255917 AGGACCTTCCACGTGGATTCT pLKO_005 358 CDS 100% 4.950 3.465 N AKT2 n/a
17 TRCN0000022673 CGACCCAACACCTTTGTCATA pLKO.1 307 CDS 100% 4.950 3.465 N Akt2 n/a
18 TRCN0000310882 CGACCCAACACCTTTGTCATA pLKO_005 307 CDS 100% 4.950 3.465 N Akt2 n/a
19 TRCN0000000563 CCCTTAAACAACTTCTCCGTA pLKO.1 253 CDS 100% 2.640 1.848 N AKT2 n/a
20 TRCN0000000564 CTTCGACTATCTCAAACTCCT pLKO.1 555 CDS 100% 2.640 1.848 N AKT2 n/a
21 TRCN0000039971 GCACAGGTTCTTCCTCAGCAT pLKO.1 1317 CDS 100% 2.640 1.848 N AKT2 n/a
22 TRCN0000199106 CGTTCCTCACTGCGCTGAAGT pLKO.1 731 CDS 100% 1.650 1.155 N AKT2 n/a
23 TRCN0000039972 GCCACGGTACTTCCTGCTGAA pLKO.1 171 CDS 100% 1.350 0.945 N AKT2 n/a
24 TRCN0000255915 TACCGCCCAGTCCATCACAAT pLKO_005 1431 CDS 100% 0.000 0.000 N AKT2 n/a
25 TRCN0000265834 CGGCTCCTTCATTGGGTACAA pLKO_005 198 CDS 100% 4.950 2.970 N AKT2 n/a
26 TRCN0000055260 TGACCATGAATGACTTCGATT pLKO.1 542 CDS 100% 4.950 3.465 N Akt2 n/a
27 TRCN0000301309 TGACCATGAATGACTTCGATT pLKO_005 542 CDS 100% 4.950 3.465 N Akt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526614.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00047 pDONR223 100% 100% 100% None n/a
2 TRCN0000465582 CAAAGCGCTGTATGATGGCGTGGG pLX_317 21.7% 100% 100% V5 n/a
3 ccsbBroad304_00047 pLX_304 46.7% 96.8% 58.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488903 TTGCCCCAATCACATTTTCGGAAA pLX_317 23.4% 99.9% 100% V5 (not translated due to prior stop codon) 78C>T n/a
5 TRCN0000489868 CTATGATACTTTATCATCGTTCTT pLX_317 12.8% 97.2% 97.1% V5 (many diffs) n/a
6 TRCN0000488553 GACATAAACATAGCTAACAAAGGT pLX_317 21.9% 96.9% 97.1% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10674 pDONR223 100% 28.5% 20.4% None (many diffs) n/a
8 ccsbBroad304_10674 pLX_304 0% 28.5% 20.4% V5 (many diffs) n/a
9 TRCN0000472076 CATCTATTTCCCGTCATATGACAA pLX_317 75.2% 28.5% 20.4% V5 (many diffs) n/a
Download CSV