Construct: ORF TRCN0000465612
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010196.1_s317c1
- Derived from:
- ccsbBroadEn_01775
- DNA Barcode:
- TACCCCGGGAGATTTTAATAAGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EIF4H (7458)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465612
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7458 | EIF4H | eukaryotic translation init... | NM_031992.2 | 100% | 100% | |
| 2 | human | 7458 | EIF4H | eukaryotic translation init... | NM_022170.2 | 91.9% | 91.9% | 409_468del |
| 3 | mouse | 22384 | Eif4h | eukaryotic translation init... | NM_001312867.1 | 90.7% | 99.1% | (many diffs) |
| 4 | mouse | 22384 | Eif4h | eukaryotic translation init... | NM_033561.2 | 83.4% | 91.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 750
- ORF length:
- 684
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggacttcgac acctacgacg atcgggccta cagcagcttc ggcggcggca 121 gagggtcccg cggcagtgct ggtggccatg gttcccgtag ccagaaggag ttgcccacag 181 agccccccta cacagcatac gtaggaaatc tacctttcaa tacggttcag ggcgacatag 241 atgctatctt taaggatctc agcataagga gtgtacggct agtcagagac aaagacacag 301 ataaatttaa aggattctgc tatgtagaat tcgatgaagt ggattccctt aaggaagcct 361 tgacatacga tggtgcactg ttgggcgatc ggtcacttcg tgtggacatt gcagaaggca 421 gaaaacaaga taaaggtggc tttGGATTCA GAAAAGGTGG ACCAGATGAC AGAGGCTTCA 481 GGGATGACTT CTTAGGGGGC AGGGGAGGTA GTCGCCCAGG CGACCGGCGA ACAGGCCCCC 541 CCATGGGCAG CCGCTTCAGA GATGGCCCTC CCCTCCGTGG ATCCAACATG GATTTCAGAG 601 AACCCACAGA AGAGGAAAGA GCACAGAGAC CACGACTCCA GCTTAAACCT CGAACAGTCG 661 CGACGCCCCT CAATCAAGTA GCCAATCCCA ACTCTGCTAT CTTCGGGGGT GCCAGGCCTA 721 GAGAGGAAGT CGTTCAAAAG GAGCAAGAAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 781 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 841 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATACCC 901 CGGGAGATTT TAATAAGACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 961 tgaaagatt