Transcript: Human NM_031992.2

Homo sapiens eukaryotic translation initiation factor 4H (EIF4H), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
EIF4H (7458)
Length:
2503
CDS:
29..715

Additional Resources:

NCBI RefSeq record:
NM_031992.2
NBCI Gene record:
EIF4H (7458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275601 GAGTGCATGTCAGCTGTTAAC pLKO_005 849 3UTR 100% 10.800 15.120 N EIF4H n/a
2 TRCN0000153576 GATCTCAGCATAAGGAGTGTA pLKO.1 218 CDS 100% 4.950 6.930 N EIF4H n/a
3 TRCN0000275667 GATCTCAGCATAAGGAGTGTA pLKO_005 218 CDS 100% 4.950 6.930 N EIF4H n/a
4 TRCN0000157061 GACTCCAGCTTAAACCTCGAA pLKO.1 597 CDS 100% 2.640 3.696 N EIF4H n/a
5 TRCN0000151553 GCTTCTGAGATAAGAACCATT pLKO.1 2215 3UTR 100% 4.950 3.960 N EIF4H n/a
6 TRCN0000275604 GCGACATAGATGCTATCTTTA pLKO_005 195 CDS 100% 13.200 9.240 N EIF4H n/a
7 TRCN0000153719 CAATCCCAACTCTGCTATCTT pLKO.1 646 CDS 100% 5.625 3.938 N EIF4H n/a
8 TRCN0000177896 CTATCTTTAAGGATCTCAGCA pLKO.1 207 CDS 100% 2.640 1.848 N Eif4h n/a
9 TRCN0000275697 GAGACAAAGACACAGATAAAT pLKO_005 249 CDS 100% 15.000 9.000 N EIF4H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01775 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01775 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465612 TACCCCGGGAGATTTTAATAAGAC pLX_317 45% 100% 100% V5 n/a
Download CSV