Construct: ORF TRCN0000465615
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013895.1_s317c1
- Derived from:
- ccsbBroadEn_02253
- DNA Barcode:
- TCCCAGAAATACCACCCCCGTACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPATA2 (9825)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465615
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9825 | SPATA2 | spermatogenesis associated 2 | NM_001135773.1 | 100% | 100% | |
| 2 | human | 9825 | SPATA2 | spermatogenesis associated 2 | NM_006038.4 | 100% | 100% | |
| 3 | human | 9825 | SPATA2 | spermatogenesis associated 2 | XM_006723894.1 | 100% | 100% | |
| 4 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | NM_170756.2 | 84.2% | 84.4% | (many diffs) |
| 5 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | XM_006499584.2 | 84.2% | 84.4% | (many diffs) |
| 6 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | XM_006499586.3 | 84.2% | 84.4% | (many diffs) |
| 7 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | XM_017318649.1 | 84.2% | 84.4% | (many diffs) |
| 8 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | XM_017318650.1 | 84.2% | 84.4% | (many diffs) |
| 9 | mouse | 263876 | Spata2 | spermatogenesis associated 2 | XM_017318651.1 | 84.2% | 84.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1626
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaagcccagt tcaatggata ctaaattcaa ggatgactta tttcggaagt 121 acgtgcagtt ccatgagagc aaagtggata ccaccaccag caggcagcgg cctggcagcg 181 atgagtgcct gcgggtggca gcctcaaccc tgctcagcct gcacaaggtg gatccctttt 241 atcgattccg gctgatccag ttctatgagg tggtggagag ctccttgcgc tcgctcagct 301 cctctagcct gcgggctctg cacggcgcct tcagcatgct ggagacggtg ggcatcaacc 361 tcttcctcta cccgtggaag aaggaattca gaagcatcaa gacctacacg ggcccttttg 421 tttattatgt caagtcgaca ttactggaag aggacatccg agccatcctg agctgcatgg 481 gctacacacc tgagctgggc actgcataca agctcagaga gctcgtggag accctccagg 541 tgaagatggt ctcctttgag ctctttctgg ccaaagtcga gtgtgagcag atgctagaaa 601 tccactcaca agtgaaggac aagggctact ccgagctgga cattgtgagc gagcgcaaga 661 gcagtgcaga ggatgtgcgc ggctgctcgg acgccctgcg gcggcgggca gagggccggg 721 agcacctgac ggcctccatg tcacgagtgg cactccagaa gtcggccagc gagcgggcgg 781 ccaaggacta ctacaagccc cgcgtgacca agccctcgag gtcagtggat gcctatgaca 841 gctactggga gagccggaag ccacccctga aggcctcatt gagtcttcgg aaggagcctg 901 tggcaacgga tgtgggggac gacctcaagg atgagatcat ccgcccatcc ccttcgctgc 961 tgaccatggc cagctccccc cacggcagcc cggatgtgct tccacccgcc tcccccagca 1021 acggcccggc cctgctgcgc ggtacctact tctccactca ggatgacgtg gatctgtaca 1081 cagactctga acccagggcc acctaccgtc ggcaggatgc tctgcggccg gatgtgtggc 1141 tgctcagaaa cgatgcccac tccctctacc acaagcgctc gccccctgcc aaagagtccg 1201 ccctctccaa gtgccaaagc tgcgggctgt cctgcagctc ctcccTCTGC CAGCGCTGTG 1261 ACAGCCTGCT CACCTGTCCT CCAGCTTCCA AGCCCAGCGC CTTCCCCAGC AAGGCCTCGA 1321 CTCATGACAG CCTGGCCCAC GGGGCATCTC TGCGGGAGAA GTACCCAGGC CAGACTCAGG 1381 GCCTCGACCG CCTCCCGCAC CTTCACTCCA AATCCAAGCC CTCCACCACG CCCACTTCCC 1441 GCTGTGGCTT CTGCAACCGC CCAGGCGCCA CCAACACCTG CACCCAGTGT TCAAAAGTCT 1501 CATGTGACGC CTGCCTCAGC GCTTACCATT ATGACCCCTG CTACAAAAAG AGTGAGCTGC 1561 ACAAGTTCAT GCCCAACAAC CAGCTGAACT ACAAGTCCAC CCAGCTCTCC CATCTCGTGT 1621 ACAGATACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1681 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1741 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATCCCAGAAA TACCACCCCC GTACAACGCG 1801 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt