Transcript: Human NM_006038.4

Homo sapiens spermatogenesis associated 2 (SPATA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SPATA2 (9825)
Length:
4043
CDS:
253..1815

Additional Resources:

NCBI RefSeq record:
NM_006038.4
NBCI Gene record:
SPATA2 (9825)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006038.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435837 TCCACGTGGGAGTTCACTTAG pLKO_005 1957 3UTR 100% 10.800 15.120 N SPATA2 n/a
2 TRCN0000180843 GCGCCAGCATTACAGTAACTA pLKO.1 3715 3UTR 100% 5.625 7.875 N SPATA2 n/a
3 TRCN0000146374 CGAGTCCAGTATTAGCTGAAT pLKO.1 2403 3UTR 100% 4.950 6.930 N SPATA2 n/a
4 TRCN0000148249 CAAGGATGACTTATTTCGGAA pLKO.1 285 CDS 100% 2.640 3.696 N SPATA2 n/a
5 TRCN0000149222 GTGTGAGCAGATGCTAGAAAT pLKO.1 768 CDS 100% 13.200 9.240 N SPATA2 n/a
6 TRCN0000181057 CAGGTGAAGATGGTCTCCTTT pLKO.1 724 CDS 100% 4.950 3.465 N SPATA2 n/a
7 TRCN0000180214 CCACTCACAAGTGAAGGACAA pLKO.1 789 CDS 100% 4.050 2.835 N SPATA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006038.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02253 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02253 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465615 TCCCAGAAATACCACCCCCGTACA pLX_317 24.7% 100% 100% V5 n/a
Download CSV