Transcript: Mouse XM_017318650.1

PREDICTED: Mus musculus spermatogenesis associated 2 (Spata2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata2 (263876)
Length:
3792
CDS:
1461..3008

Additional Resources:

NCBI RefSeq record:
XM_017318650.1
NBCI Gene record:
Spata2 (263876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318650.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106437 CCGAGCCATTCTAAGGTTCAT pLKO.1 1835 CDS 100% 4.950 3.960 N Spata2 n/a
2 TRCN0000106438 GTGGACCCTTTATATCGATTT pLKO.1 1605 CDS 100% 10.800 7.560 N Spata2 n/a
3 TRCN0000106436 CCTTCTTCGTAGTACATACTT pLKO.1 2408 CDS 100% 5.625 3.938 N Spata2 n/a
4 TRCN0000181057 CAGGTGAAGATGGTCTCCTTT pLKO.1 1914 CDS 100% 4.950 3.465 N SPATA2 n/a
5 TRCN0000430502 GAGCAGCCAAGGACTACTACA pLKO_005 2152 CDS 100% 4.950 3.465 N Spata2 n/a
6 TRCN0000106439 CAGAAAGAGTGAGCTGCACAA pLKO.1 2924 CDS 100% 4.050 2.835 N Spata2 n/a
7 TRCN0000425795 TACTATGTCAAGTCCACGTTG pLKO_005 1800 CDS 100% 4.050 2.835 N Spata2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318650.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02253 pDONR223 100% 84.2% 84.4% None (many diffs) n/a
2 ccsbBroad304_02253 pLX_304 0% 84.2% 84.4% V5 (many diffs) n/a
3 TRCN0000465615 TCCCAGAAATACCACCCCCGTACA pLX_317 24.7% 84.2% 84.4% V5 (many diffs) n/a
Download CSV