Construct: ORF TRCN0000465787
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015488.1_s317c1
- Derived from:
- ccsbBroadEn_06681
- DNA Barcode:
- GGAACCTTAGAGGTTGTACTTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- P2RY2 (5029)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465787
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_002564.4 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 2 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176071.3 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 3 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | NM_176072.3 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 4 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274019.4 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 5 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274020.4 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 6 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_005274021.4 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 7 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_011545074.2 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 8 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XM_017017839.1 | 99.7% | 99.4% | 137C>T;816C>T;936G>C |
| 9 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747891.1 | 53.8% | (many diffs) | |
| 10 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747890.1 | 45.9% | (many diffs) | |
| 11 | human | 5029 | P2RY2 | purinergic receptor P2Y2 | XR_001747892.1 | 34.9% | (many diffs) | |
| 12 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302346.1 | 84.6% | 89.3% | (many diffs) |
| 13 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_001302347.1 | 84.6% | 89.3% | (many diffs) |
| 14 | mouse | 18442 | P2ry2 | purinergic receptor P2Y, G-... | NM_008773.4 | 84.6% | 89.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agcagacctg ggcccctgga atgacaccat caatggcacc tgggatgggg 121 atgagctggg ctacaggtgc cgcttcaacg aggacttcaa gtacgtgctg ctgcctgtgt 181 cctacggcgt ggtgtgcgtg cttgggctgt gtctgaacgc cgtggcgctc tacatcttct 241 tgtgccgcct caagacctgg aatgcgtcca ccacatatat gttccacctg gctgtgtctg 301 atgcactgta tgcggcctcc ctgccgctgc tggtctatta ctacgcccgc ggcgaccact 361 ggcccttcag cacggtgctc tgcaagctgg tgcgcttcct cttctacacc aacctttact 421 gcagcatcct cttcctcacc tgcatcagcg tgcaccggtg tctgggcgtc ttacgacctc 481 tgcgctccct gcgctggggc cgggcccgct acgctcgccg ggtggccggg gccgtgtggg 541 tgttggtgct ggcctgccag gcccccgtgc tctactttgt caccaccagc gcgcgcgggg 601 gccgcgtaac ctgccacgac acctcggcac ccgagctctt cagccgcttc gtggcctaca 661 gctcagtcat gctgggcctg ctcttcgcgg tgccctttgc cgtcatcctt gtctgttacg 721 tgctcatggc tcggcgactg ctaaagccag cctacgggac ctcgggcggc ctgcctaggg 781 ccaagcgcaa gtccgtgcgc accatcgccg tggtgctggc tgtcttcgcc ctctgcttcc 841 tgccattcca cgtcacccgc accctctact actccTTCCG TTCGCTGGAC CTCAGCTGCC 901 ACACCCTCAA CGCCATCAAC ATGGCCTACA AGGTTACCCG GCCGCTGGCC AGTGCTAACA 961 GTTGCCTTGA CCCCGTGCTC TACTTCCTGG CTGGGCAGAG CCTCGTACGC TTTGCCCGAG 1021 ATGCCAAGCC ACCCACTGGC CCCAGCCCTG CCACCCCGGC TCGCCGCAGG CTGGGCCTGC 1081 GCAGATCCGA CAGAACTGAC ATGCAGAGGA TAGAAGATGT GTTGGGCAGC AGTGAGGACT 1141 CTAGGCGGAC AGAGTCCACG CCGGCTGGTA GCGAGAACAC TAAGGACATT CGGCTGTACC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GAGGAACCTT AGAGGTTGTA CTTGTCACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt