Transcript: Mouse NM_001302347.1

Mus musculus purinergic receptor P2Y, G-protein coupled 2 (P2ry2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
P2ry2 (18442)
Length:
2820
CDS:
292..1413

Additional Resources:

NCBI RefSeq record:
NM_001302347.1
NBCI Gene record:
P2ry2 (18442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220810 CCTGCCGCTGTTGGTTTATTA pLKO.1 546 CDS 100% 15.000 21.000 N P2ry2 n/a
2 TRCN0000220811 GTGTCGTTTCAACGAGGACTT pLKO.1 363 CDS 100% 4.050 5.670 N P2ry2 n/a
3 TRCN0000220807 CGCCATCAACATGGCATATAA pLKO.1 1137 CDS 100% 1.500 2.100 N P2ry2 n/a
4 TRCN0000220808 CCTGGTCTGTTACGTGCTTAT pLKO.1 933 CDS 100% 10.800 7.560 N P2ry2 n/a
5 TRCN0000220809 GCCTAACAGAACTGTGAGGAA pLKO.1 1311 CDS 100% 2.640 1.584 N P2ry2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15516 pDONR223 0% 84.6% 89.6% None (many diffs) n/a
2 ccsbBroad304_15516 pLX_304 0% 84.6% 89.6% V5 (many diffs) n/a
3 TRCN0000465361 CACACGATAAGACCAAAGCAAGTG pLX_317 27.4% 84.6% 89.6% V5 (many diffs) n/a
4 ccsbBroadEn_06681 pDONR223 100% 84.6% 89.3% None (many diffs) n/a
5 ccsbBroad304_06681 pLX_304 0% 84.6% 89.3% V5 (many diffs) n/a
6 TRCN0000465787 GGAACCTTAGAGGTTGTACTTGTC pLX_317 28.8% 84.6% 89.3% V5 (many diffs) n/a
7 TRCN0000491893 GCTTTAGCACGCGGGGGTTGGAAG pLX_317 29.6% 84.6% 89.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489343 CCAAATCTATTTCTGTATCAGGAC pLX_317 27.2% 84.5% 89.4% V5 (many diffs) n/a
Download CSV