Transcript: Human NM_002564.4

Homo sapiens purinergic receptor P2Y2 (P2RY2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
P2RY2 (5029)
Length:
8619
CDS:
352..1485

Additional Resources:

NCBI RefSeq record:
NM_002564.4
NBCI Gene record:
P2RY2 (5029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002564.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358030 GAATGCGTCCACCACATATAT pLKO_005 546 CDS 100% 15.000 21.000 N P2RY2 n/a
2 TRCN0000358029 GCGAGAACACTAAGGACATTC pLKO_005 1457 CDS 100% 10.800 8.640 N P2RY2 n/a
3 TRCN0000358031 TTCAGCCTGTGCAGGTTTATA pLKO_005 1497 3UTR 100% 15.000 10.500 N P2RY2 n/a
4 TRCN0000011797 GCCAGTCATGTGCTGGTAAAT pLKO.1 2395 3UTR 100% 13.200 9.240 N P2RY2 n/a
5 TRCN0000358028 TGGCTTACCAAGATCACATAC pLKO_005 1850 3UTR 100% 10.800 7.560 N P2RY2 n/a
6 TRCN0000009481 GCAGAGGATAGAAGATGTGTT pLKO.1 1389 CDS 100% 4.950 3.465 N P2RY2 n/a
7 TRCN0000009480 GCTGTGTCTGATGCACTGTAT pLKO.1 577 CDS 100% 4.950 3.465 N P2RY2 n/a
8 TRCN0000011798 CCTTGTCTGTTACGTGCTCAT pLKO.1 993 CDS 100% 4.050 2.835 N P2RY2 n/a
9 TRCN0000009482 GCCAGTGCTAACAGTTGCCTT pLKO.1 1234 CDS 100% 2.640 1.848 N P2RY2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3697 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3697 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002564.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15516 pDONR223 0% 99.9% 99.7% None 137C>T n/a
2 ccsbBroad304_15516 pLX_304 0% 99.9% 99.7% V5 137C>T n/a
3 TRCN0000465361 CACACGATAAGACCAAAGCAAGTG pLX_317 27.4% 99.9% 99.7% V5 137C>T n/a
4 TRCN0000491893 GCTTTAGCACGCGGGGGTTGGAAG pLX_317 29.6% 99.8% 99.7% V5 (not translated due to prior stop codon) 137C>T;816C>T n/a
5 TRCN0000489343 CCAAATCTATTTCTGTATCAGGAC pLX_317 27.2% 99.7% 99.4% V5 137C>T;816C>T;1131_1132insG n/a
6 ccsbBroadEn_06681 pDONR223 100% 99.7% 99.4% None 137C>T;816C>T;936G>C n/a
7 ccsbBroad304_06681 pLX_304 0% 99.7% 99.4% V5 137C>T;816C>T;936G>C n/a
8 TRCN0000465787 GGAACCTTAGAGGTTGTACTTGTC pLX_317 28.8% 99.7% 99.4% V5 137C>T;816C>T;936G>C n/a
Download CSV