Construct: ORF TRCN0000465811
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010135.1_s317c1
- Derived from:
- ccsbBroadEn_04007
- DNA Barcode:
- ATATCTGGTCCATGAATATCTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC61 (65999)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465811
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 65999 | LRRC61 | leucine rich repeat contain... | NM_001142928.2 | 100% | 100% | |
| 2 | human | 65999 | LRRC61 | leucine rich repeat contain... | NM_001363433.1 | 100% | 100% | |
| 3 | human | 65999 | LRRC61 | leucine rich repeat contain... | NM_001363434.1 | 100% | 100% | |
| 4 | human | 65999 | LRRC61 | leucine rich repeat contain... | NM_023942.3 | 100% | 100% | |
| 5 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | NM_001110160.1 | 83.9% | 87.6% | (many diffs) |
| 6 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | NM_177736.3 | 83.9% | 87.6% | (many diffs) |
| 7 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | XM_006506072.2 | 83.9% | 87.6% | (many diffs) |
| 8 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | XM_006506073.2 | 83.9% | 87.6% | (many diffs) |
| 9 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | XM_006506074.2 | 83.9% | 87.6% | (many diffs) |
| 10 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | XM_006506075.2 | 83.9% | 87.6% | (many diffs) |
| 11 | mouse | 243371 | Lrrc61 | leucine rich repeat contain... | XM_006506076.2 | 83.9% | 87.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 843
- ORF length:
- 777
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccctccagcg gagaagccgg gagaggctgg cggactgcag atcacacccc 121 agctgctgaa gtcacgcaca ggcgagttct ccctggagtc catcctgcta ctgaagctgc 181 gtggcttggg actggctgac ctgggctgcc tgggagagtg cctgggcctg gagtggctgg 241 acctatcagg caacgcgctc acccacctgg gcccgctggc ctccttgcgc cagctagctg 301 tgctcaatgt ctccaacaat cggctgacgg gcctggagcc actggccacc tgtgagaact 361 tgcagagtct caatgccgca ggcaacctac tggccacccc gggccagctg cagtgtctgg 421 ctgggctacc gtgcctggag taccTGCGGC TCCGAGACCC TTTGGCCCGG CTCAGCAACC 481 CGCTCTGTGC CAACCCCTCC TACTGGGCTG CAGTCCGGGA GCTGCTGCCT GGCCTGAAAG 541 TCATCGACGG TGAGCGTGTG ATTGGGCGTG GTAGTGAGTT CTACCAGCTG TGCCGAGACC 601 TGGACAGCTC CTTGCGTCCC AGCTCCAGTC CAGGCCCCAG AGCCACCGAG GCCCAGCCCT 661 GGGTGGAGCC AGGCTACTGG GAGTCCTGGC CCAGCCGGAG CAGCTCCATC CTGGAGGAGG 721 CCTGCCGGCA GTTCCAGGAC ACACTGCAGG AGTGCTGGGA CCTGGACCGC CAGGCCAGCG 781 ACAGCCTGGC CCAGGCGGAG CAGGTACTCA GCTCTGCGGG CCCCACCTCT TCCTTCGTCT 841 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGAAT ATCTGGTCCA TGAATATCTT TCACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt