Transcript: Human NM_001363434.1

Homo sapiens leucine rich repeat containing 61 (LRRC61), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-02
Taxon:
Homo sapiens (human)
Gene:
LRRC61 (65999)
Length:
2011
CDS:
717..1496

Additional Resources:

NCBI RefSeq record:
NM_001363434.1
NBCI Gene record:
LRRC61 (65999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245581 GCACACTGGGCTATTGCTTTA pLKO_005 1602 3UTR 100% 10.800 15.120 N LRRC61 n/a
2 TRCN0000245582 GTCTTCTGAACGTGGCCTATG pLKO_005 1488 CDS 100% 6.000 8.400 N LRRC61 n/a
3 TRCN0000245578 TTGGGCGTGGTAGTGAGTTCT pLKO_005 1213 CDS 100% 4.950 3.960 N LRRC61 n/a
4 TRCN0000245579 TGCTCAATGTCTCCAACAATC pLKO_005 952 CDS 100% 10.800 7.560 N LRRC61 n/a
5 TRCN0000245580 GGAGTCCATCCTGCTACTGAA pLKO_005 806 CDS 100% 4.950 3.465 N LRRC61 n/a
6 TRCN0000180730 GTAGTGAGTTCTACCAGCTGT pLKO.1 1222 CDS 100% 2.640 1.848 N LRRC61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04007 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04007 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465811 ATATCTGGTCCATGAATATCTTTC pLX_317 51.3% 100% 100% V5 n/a
Download CSV