Construct: ORF TRCN0000465827
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012909.1_s317c1
- Derived from:
- ccsbBroadEn_02297
- DNA Barcode:
- TTAGACAAGAGATTTTGGCTGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DNAJB6 (10049)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465827
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | NM_058246.4 | 100% | 100% | |
| 2 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | XM_005249515.3 | 93.3% | 91% | (many diffs) |
| 3 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | XM_005249516.2 | 93.3% | 91% | (many diffs) |
| 4 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | XM_011515704.1 | 93.3% | 91% | (many diffs) |
| 5 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | XM_006715823.2 | 78.8% | 78.8% | 690_691ins207 |
| 6 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | NM_005494.3 | 72.1% | 71.7% | (many diffs) |
| 7 | human | 10049 | DNAJB6 | DnaJ heat shock protein fam... | NM_001363676.1 | 64.7% | 64.7% | 344_345ins345 |
| 8 | mouse | 23950 | Dnajb6 | DnaJ heat shock protein fam... | NM_001037940.4 | 76.7% | 75.6% | (many diffs) |
| 9 | mouse | 23950 | Dnajb6 | DnaJ heat shock protein fam... | XM_006535707.3 | 72.1% | 68.9% | (many diffs) |
| 10 | mouse | 23950 | Dnajb6 | DnaJ heat shock protein fam... | XM_006535708.3 | 71.5% | 74.3% | (many diffs) |
| 11 | mouse | 23950 | Dnajb6 | DnaJ heat shock protein fam... | NM_011847.4 | 65.5% | 68.1% | (many diffs) |
| 12 | mouse | 23950 | Dnajb6 | DnaJ heat shock protein fam... | NM_001127367.1 | 65.2% | 67.8% | (many diffs) |
| 13 | mouse | 546133 | Gm5917 | predicted gene 5917 | XM_011242843.2 | 64.5% | 66.4% | (many diffs) |
| 14 | mouse | 102633596 | LOC102633596 | dnaJ homolog subfamily B me... | XR_391160.2 | 17% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggattactat gaagttctag gcgtgcagag acatgcctca cccgaggata 121 ttaaaaaggc atatcggaaa ctggcactga agtggcatcc agataaaaat cctgagaata 181 aagaagaagc agagagaaaa ttcaagcaag tagcggaggc atatgaagtg ctgtcggatg 241 ctaagaaacg ggacatctat gacaaatatg gcaaagaagg attaaatggt ggaggaggag 301 gtggaagtca ttttgacagt ccatttgaat ttggcttcac attccgtaac ccagatgatg 361 tcttcaggga attttttggt ggaagggacc cattttcatt tgacttcttt gaagaccctt 421 ttgaggactt ctttgggaat cgaaggggtc cccgaggaag cagaagccga gggacggggt 481 cgtttttctc tgcgttcagt ggatttccgt cttttggaag tggattttct tcttttgata 541 caggatttac ttcatttggg tcactaggtc acgggggcct cacttcattc tcttccacgt 601 catttggtgg tagtggcatg ggcaacttca aatcgatatc aacttcaact aaaatggtta 661 atggcagaaa aatcactaca aagagaattg tcgagaacgg tcaagaaaga gtagaagttg 721 aagaagatgg ccagttaaag tccttaacaa taaatggtgt ggccgacgac gatgccctcg 781 cTGAGGAGCG CATGCGGAGA GGCCAGAACG CCCTGCCAGC CCAGCCTGCC GGCCTCCGCC 841 CGCCGAAGCC GCCCCGGCCT GCCTCGCTGC TGAGACACGC GCCTCACTGT CTCTCTGAGG 901 AGGAGGGCGA GCAGGACCGA CCTCGGGCAC CCGGGCCCTG GGACCCCCTC GCGTCCGCAG 961 CAGGATTGAA AGAAGGTGGC AAGAGGAAGA AGCAGAAGCA GAGAGAGGAG TCGAAGAAGA 1021 AGAAGTCGAC CAAAGGCAAT CACTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT TAGACAAGAG 1201 ATTTTGGCTG ACAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att