Transcript: Mouse XM_006535707.3

PREDICTED: Mus musculus DnaJ heat shock protein family (Hsp40) member B6 (Dnajb6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dnajb6 (23950)
Length:
1796
CDS:
451..1569

Additional Resources:

NCBI RefSeq record:
XM_006535707.3
NBCI Gene record:
Dnajb6 (23950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006535707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008561 CCAGATGATGTCTTCAGGGAA pLKO.1 739 CDS 100% 2.640 1.584 N Dnajb6 n/a
2 TRCN0000008559 CGGGACATCTACGACAAATAT pLKO.1 634 CDS 100% 15.000 7.500 Y Dnajb6 n/a
3 TRCN0000321351 CGGGACATCTACGACAAATAT pLKO_005 634 CDS 100% 15.000 7.500 Y Dnajb6 n/a
4 TRCN0000008558 GCCTCACCTGAGGACATTAAA pLKO.1 490 CDS 100% 15.000 7.500 Y Dnajb6 n/a
5 TRCN0000321280 GCCTCACCTGAGGACATTAAA pLKO_005 490 CDS 100% 15.000 7.500 Y Dnajb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006535707.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02297 pDONR223 100% 72.1% 68.9% None (many diffs) n/a
2 ccsbBroad304_02297 pLX_304 0% 72.1% 68.9% V5 (many diffs) n/a
3 TRCN0000465827 TTAGACAAGAGATTTTGGCTGACA pLX_317 27.3% 72.1% 68.9% V5 (many diffs) n/a
Download CSV