Transcript: Human NM_005494.3

Homo sapiens DnaJ heat shock protein family (Hsp40) member B6 (DNAJB6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DNAJB6 (10049)
Length:
1571
CDS:
168..893

Additional Resources:

NCBI RefSeq record:
NM_005494.3
NBCI Gene record:
DNAJB6 (10049)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008781 GCCTCACCCGAGGATATTAAA pLKO.1 207 CDS 100% 15.000 21.000 N DNAJB6 n/a
2 TRCN0000293396 GCCTCACCCGAGGATATTAAA pLKO_005 207 CDS 100% 15.000 21.000 N DNAJB6 n/a
3 TRCN0000293467 TCGATATCAACTTCAACTAAA pLKO_005 735 CDS 100% 13.200 18.480 N DNAJB6 n/a
4 TRCN0000008779 CGTTCAGTGGATTTCCGTCTT pLKO.1 595 CDS 100% 4.050 5.670 N DNAJB6 n/a
5 TRCN0000298503 CGTTCAGTGGATTTCCGTCTT pLKO_005 595 CDS 100% 4.050 5.670 N DNAJB6 n/a
6 TRCN0000008777 CGCACTTAACAGAAATGTTAA pLKO.1 903 3UTR 100% 1.320 1.056 N DNAJB6 n/a
7 TRCN0000008778 CGGGACATCTATGACAAATAT pLKO.1 351 CDS 100% 15.000 10.500 N DNAJB6 n/a
8 TRCN0000293400 TCATTCTCTTCCACGTCATTT pLKO_005 687 CDS 100% 13.200 9.240 N DNAJB6 n/a
9 TRCN0000293469 TGATTGTTGGGACCACATAAT pLKO_005 1061 3UTR 100% 13.200 9.240 N DNAJB6 n/a
10 TRCN0000008780 CCAGTTAAAGTCCTTAACAAT pLKO.1 833 CDS 100% 0.563 0.394 N DNAJB6 n/a
11 TRCN0000008561 CCAGATGATGTCTTCAGGGAA pLKO.1 453 CDS 100% 2.640 1.584 N Dnajb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005494.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02297 pDONR223 100% 72.1% 71.7% None (many diffs) n/a
2 ccsbBroad304_02297 pLX_304 0% 72.1% 71.7% V5 (many diffs) n/a
3 TRCN0000465827 TTAGACAAGAGATTTTGGCTGACA pLX_317 27.3% 72.1% 71.7% V5 (many diffs) n/a
Download CSV