Construct: ORF TRCN0000465977
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004747.1_s317c1
- Derived from:
- ccsbBroadEn_15060
- DNA Barcode:
- GACACAGAGAGTCTTGACGCTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IRAK4 (51135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465977
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001114182.2 | 99.9% | 100% | 291G>A |
| 2 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351345.1 | 99.9% | 100% | 291G>A |
| 3 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_016123.3 | 99.9% | 100% | 291G>A |
| 4 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268943.3 | 99.9% | 100% | 291G>A |
| 5 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268944.4 | 99.9% | 100% | 291G>A |
| 6 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268945.4 | 99.9% | 100% | 291G>A |
| 7 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719438.3 | 99.9% | 100% | 291G>A |
| 8 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_011538431.2 | 99.9% | 100% | 291G>A |
| 9 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_011538433.2 | 99.9% | 100% | 291G>A |
| 10 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_017019390.2 | 99.9% | 100% | 291G>A |
| 11 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145256.1 | 73% | 73% | 0_1ins372 |
| 12 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145257.1 | 73% | 73% | 0_1ins372 |
| 13 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001145258.1 | 73% | 73% | 0_1ins372 |
| 14 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351338.1 | 73% | 73% | 0_1ins372 |
| 15 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351339.1 | 73% | 73% | 0_1ins372 |
| 16 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351340.1 | 73% | 73% | 0_1ins372 |
| 17 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351341.1 | 73% | 73% | 0_1ins372 |
| 18 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351342.1 | 73% | 73% | 0_1ins372 |
| 19 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_005268949.2 | 73% | 73% | 0_1ins372 |
| 20 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351343.1 | 55.8% | 53.1% | 0_1ins523;42_43ins86 |
| 21 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | NM_001351344.1 | 55.8% | 53.1% | 0_1ins523;42_43ins86 |
| 22 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719440.2 | 55.8% | 53.1% | 0_1ins523;42_43ins86 |
| 23 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_006719442.2 | 55.8% | 53.1% | 0_1ins523;42_43ins86 |
| 24 | human | 51135 | IRAK4 | interleukin 1 receptor asso... | XM_024449008.1 | 50.6% | 47% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1446
- ORF length:
- 1380
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa caaacccata acaccatcaa catatgtgcg ctgcctcaat gttggactaa 121 ttaggaagct gtcagatttt attgatcctc aagaaggatg gaagaagtta gctgtagcta 181 ttaaaaaacc atctggtgat gatagataca atcagtttca cataaggaga tttgaagcat 241 tacttcaaac tggaaaaagt cccacttctg aattactgtt tgactggggc accacaaatt 301 gcacagttgg tgatcttgtg gatcttttga tccaaaatga attttttgct cctgcaagtc 361 ttttgctccc agatgctgtt cccaaaactg ctaatacact accttctaaa gaagctataa 421 cagttcagca aaaacagatg cctttctgtg acaaagacag gacattgatg acacctgtgc 481 agaatcttga acaaagctat atgccacctg actcctcaag tccagaaaat aaaagtttag 541 aagttagtga tacacgtttt cacagttttt cattttatga attgaagaat gtcacaaata 601 actttgatga acgacccatt tctgttggtg gtaataaaat gggagaggga ggatttggag 661 ttgtatataa aggctacgta aataacacaa ctgtggcagt gaagaagctt gcagcaatgg 721 ttgacattac tactgaagaa ctgaaacagc agtttgatca agaaataaaa gtaatggcaa 781 agtgtcaaca tgaaaactta gtagaactac ttggtttctc aagtgatgga gatgacctct 841 gcttagtata tgtttacatg cctaatggtt cattgctaga cagactctct tgcttggatg 901 gtactccacc actttcttgg cacatgagat gcaagattgc tcagggtgca gctaatggca 961 tcaattttct acatgaaaat catcatattc atagagatat taaaagtgca aatatcttac 1021 tggatgaagc ttttactgct aaaatatctg actttGGCCT TGCACGGGCT TCTGAGAAGT 1081 TTGCCCAGAC AGTCATGACT AGCAGAATTG TGGGAACAAC AGCTTATATG GCACCAGAAG 1141 CTTTGCGTGG AGAAATAACA CCCAAATCTG ATATTTACAG CTTTGGTGTG GTTTTACTAG 1201 AAATAATAAC TGGACTTCCA GCTGTGGATG AACACCGTGA ACCTCAGTTA TTGCTAGATA 1261 TTAAAGAAGA AATTGAAGAT GAAGAAAAGA CAATTGAAGA TTATATTGAT AAAAAGATGA 1321 ATGATGCTGA TTCCACTTCA GTTGAAGCTA TGTACTCTGT TGCTAGTCAA TGTCTGCATG 1381 AAAAGAAAAA TAAGAGACCA GACATTAAGA AGGTTCAACA GCTGCTGCAA GAGATGACAG 1441 CTTCTTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1501 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1561 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGACACAGAG AGTCTTGACG CTATTACGCG 1621 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt