Transcript: Human XM_024449008.1

PREDICTED: Homo sapiens interleukin 1 receptor associated kinase 4 (IRAK4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRAK4 (51135)
Length:
1643
CDS:
107..823

Additional Resources:

NCBI RefSeq record:
XM_024449008.1
NBCI Gene record:
IRAK4 (51135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010679 GCTAATACACTACCTTCTAAA pLKO.1 431 CDS 100% 13.200 18.480 N IRAK4 n/a
2 TRCN0000420822 GAAGTTAGCTGTAGCTATTAA pLKO_005 205 CDS 100% 15.000 10.500 N IRAK4 n/a
3 TRCN0000002063 CAGTTTCACATAAGGAGATTT pLKO.1 254 CDS 100% 13.200 9.240 N IRAK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449008.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489711 TCTTTTCCTTCAGCCAATCTGCCC pLX_317 28.5% 50.6% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491357 GGATTTTCATCCTAAGTGTTCCGT pLX_317 6.5% 50.6% 47% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488753 CAGATCAGTTTGAACTTCGAGATT pLX_317 21.9% 50.6% 46.9% V5 (many diffs) n/a
4 ccsbBroadEn_08230 pDONR223 100% 50.6% 47% None (many diffs) n/a
5 ccsbBroad304_08230 pLX_304 44.2% 50.6% 47% V5 (many diffs) n/a
6 TRCN0000468964 TACGGTTACCTATTCATGCAACGA pLX_317 35.1% 50.6% 47% V5 (many diffs) n/a
7 ccsbBroadEn_15060 pDONR223 0% 50.6% 47% None (many diffs) n/a
8 TRCN0000465977 GACACAGAGAGTCTTGACGCTATT pLX_317 28.6% 50.6% 47% V5 (many diffs) n/a
Download CSV