Transcript: Human XM_011538433.2

PREDICTED: Homo sapiens interleukin 1 receptor associated kinase 4 (IRAK4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IRAK4 (51135)
Length:
5025
CDS:
815..2197

Additional Resources:

NCBI RefSeq record:
XM_011538433.2
NBCI Gene record:
IRAK4 (51135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435677 CTAATAACATTGGGCTAATAT pLKO_005 2588 3UTR 100% 15.000 21.000 N IRAK4 n/a
2 TRCN0000002064 CCTCTGCTTAGTATATGTTTA pLKO.1 1585 CDS 100% 13.200 18.480 N IRAK4 n/a
3 TRCN0000010679 GCTAATACACTACCTTCTAAA pLKO.1 1139 CDS 100% 13.200 18.480 N IRAK4 n/a
4 TRCN0000435955 TTAGCCCTACCCATTAGTATC pLKO_005 2378 3UTR 100% 10.800 15.120 N IRAK4 n/a
5 TRCN0000195149 CCACTACTAATTTGCTGTAAA pLKO.1 2535 3UTR 100% 13.200 10.560 N IRAK4 n/a
6 TRCN0000435472 AGCTGACTCCACTACTAATTT pLKO_005 2527 3UTR 100% 15.000 10.500 N IRAK4 n/a
7 TRCN0000420822 GAAGTTAGCTGTAGCTATTAA pLKO_005 913 CDS 100% 15.000 10.500 N IRAK4 n/a
8 TRCN0000002063 CAGTTTCACATAAGGAGATTT pLKO.1 962 CDS 100% 13.200 9.240 N IRAK4 n/a
9 TRCN0000417618 TGCAGCTAATGGCATCAATTT pLKO_005 1696 CDS 100% 13.200 9.240 N IRAK4 n/a
10 TRCN0000413954 TTGCAGCAATGGTTGACATTA pLKO_005 1458 CDS 100% 13.200 9.240 N IRAK4 n/a
11 TRCN0000436206 GTACTCTGTTGCTAGTCAATG pLKO_005 2101 CDS 100% 10.800 7.560 N IRAK4 n/a
12 TRCN0000197137 GTGAGATAATGGGTCACATTG pLKO.1 3236 3UTR 100% 10.800 7.560 N IRAK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538433.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489711 TCTTTTCCTTCAGCCAATCTGCCC pLX_317 28.5% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000491357 GGATTTTCATCCTAAGTGTTCCGT pLX_317 6.5% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000488753 CAGATCAGTTTGAACTTCGAGATT pLX_317 21.9% 99.9% 99.7% V5 1380_1381insG n/a
4 ccsbBroadEn_08230 pDONR223 100% 99.9% 100% None 291G>A n/a
5 ccsbBroad304_08230 pLX_304 44.2% 99.9% 100% V5 291G>A n/a
6 TRCN0000468964 TACGGTTACCTATTCATGCAACGA pLX_317 35.1% 99.9% 100% V5 291G>A n/a
7 ccsbBroadEn_15060 pDONR223 0% 99.9% 100% None 291G>A n/a
8 TRCN0000465977 GACACAGAGAGTCTTGACGCTATT pLX_317 28.6% 99.9% 100% V5 291G>A n/a
Download CSV