Construct: ORF TRCN0000466004
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016625.1_s317c1
- Derived from:
- ccsbBroadEn_03187
- DNA Barcode:
- GAAGAGGTGCTTGGTCCACTGAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TXNDC12 (51060)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466004
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51060 | TXNDC12 | thioredoxin domain containi... | NM_015913.4 | 100% | 100% | |
| 2 | mouse | 66073 | Txndc12 | thioredoxin domain containi... | NM_025334.3 | 87.9% | 90.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 582
- ORF length:
- 516
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gacgcggcct cgtctcgggg ccacctgttt gctgggcttc agtttcctgc 121 tcctcgtcat ctcttctgat ggacataatg ggcttggaaa gggttttgga gatcatattc 181 attggaggac actggaagat gggaagaaag aagcagctgc cagtggactg cccctgatgg 241 tgattattca taaatcctgg tgtggagctt gcaaagctct aaagcccaaa tttgcagaat 301 ctacggaaat ttcagaactc tcccataatt ttgttatggt aaatcttgag gatgaagagg 361 aacccaaaga tgaagatttc agccctgacg ggggttatat tccacgaatc ctttttctgg 421 atcccagtgg caaggtgcat cctgaaatca tcaatgagaa tggaaacccc agctacaagt 481 atttttatgt cagtgccgag caagttgttc aggggatgaa ggaagcTCAG GAAAGGCTGA 541 CGGGTGATGC CTTCAGAAAG AAACATCTTG AAGATGAATT GTACCCAACT TTCTTGTACA 601 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 661 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 721 AGGACGAGAA GAGGTGCTTG GTCCACTGAG CACGCGTTAA GTCgacaatc aacctctgga 781 ttacaaaatt tgtgaaagat t