Transcript: Human NM_015913.4

Homo sapiens thioredoxin domain containing 12 (TXNDC12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-29
Taxon:
Homo sapiens (human)
Gene:
TXNDC12 (51060)
Length:
1416
CDS:
96..614

Additional Resources:

NCBI RefSeq record:
NM_015913.4
NBCI Gene record:
TXNDC12 (51060)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015913.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064389 GCAAAGCTCTAAAGCCCAAAT pLKO.1 301 CDS 100% 10.800 15.120 N TXNDC12 n/a
2 TRCN0000064392 GTTATATTCCACGAATCCTTT pLKO.1 424 CDS 100% 4.950 6.930 N TXNDC12 n/a
3 TRCN0000064390 CCTGATGGTGATTATTCATAA pLKO.1 263 CDS 100% 13.200 9.240 N TXNDC12 n/a
4 TRCN0000416816 TGCATCCTGAAATCATCAATG pLKO_005 466 CDS 100% 10.800 7.560 N TXNDC12 n/a
5 TRCN0000064391 CTCCTCGTCATCTCTTCTGAT pLKO.1 150 CDS 100% 4.950 3.465 N TXNDC12 n/a
6 TRCN0000064388 GCCTTCAGAAAGAAACATCTT pLKO.1 579 CDS 100% 4.950 3.465 N TXNDC12 n/a
7 TRCN0000425370 ATGTCAACTTGTCATTGAATG pLKO_005 846 3UTR 100% 10.800 6.480 N TXNDC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015913.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03187 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03187 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466004 GAAGAGGTGCTTGGTCCACTGAGC pLX_317 12.3% 100% 100% V5 n/a
4 ccsbBroadEn_08205 pDONR223 100% 99.8% 99.4% None 304G>C n/a
5 ccsbBroad304_08205 pLX_304 0% 99.8% 99.4% V5 304G>C n/a
6 TRCN0000474434 TGTTATAACTAGAAGTCTCCTGGT pLX_317 66.7% 99.8% 99.4% V5 304G>C n/a
Download CSV