Transcript: Mouse NM_025334.3

Mus musculus thioredoxin domain containing 12 (endoplasmic reticulum) (Txndc12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Txndc12 (66073)
Length:
1275
CDS:
89..601

Additional Resources:

NCBI RefSeq record:
NM_025334.3
NBCI Gene record:
Txndc12 (66073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375213 CAGCAGAGAGCGAATCCTAAA pLKO_005 628 3UTR 100% 10.800 15.120 N Txndc12 n/a
2 TRCN0000120925 GCTACAAGTATTTCTACGTCA pLKO.1 489 CDS 100% 2.640 3.696 N Txndc12 n/a
3 TRCN0000329013 TGGAGCCTGCAAAGCTTTAAA pLKO_005 280 CDS 100% 15.000 12.000 N Txndc12 n/a
4 TRCN0000329074 TTCAGAACTGTCCCATAATTT pLKO_005 328 CDS 100% 15.000 10.500 N Txndc12 n/a
5 TRCN0000120924 CTGATGGTGATCATCCATAAA pLKO.1 251 CDS 100% 13.200 9.240 N Txndc12 n/a
6 TRCN0000329071 CTGATGGTGATCATCCATAAA pLKO_005 251 CDS 100% 13.200 9.240 N Txndc12 n/a
7 TRCN0000329073 ATGAAACTCTTTGATACTAAC pLKO_005 818 3UTR 100% 10.800 7.560 N Txndc12 n/a
8 TRCN0000120922 CCATGTCAGTATTTGAGTCTT pLKO.1 862 3UTR 100% 4.950 3.465 N Txndc12 n/a
9 TRCN0000120923 GCGTCCTGAAATCATCAATGA pLKO.1 454 CDS 100% 4.950 3.465 N Txndc12 n/a
10 TRCN0000120926 GTCAGTGCTGAGCAAGTTGTT pLKO.1 506 CDS 100% 4.950 3.465 N Txndc12 n/a
11 TRCN0000375278 GTTATATCCCACGCATCCTTT pLKO_005 411 CDS 100% 4.950 3.465 N Txndc12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025334.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03187 pDONR223 100% 87.9% 90.1% None (many diffs) n/a
2 ccsbBroad304_03187 pLX_304 0% 87.9% 90.1% V5 (many diffs) n/a
3 TRCN0000466004 GAAGAGGTGCTTGGTCCACTGAGC pLX_317 12.3% 87.9% 90.1% V5 (many diffs) n/a
4 ccsbBroadEn_08205 pDONR223 100% 87.7% 89.5% None (many diffs) n/a
5 ccsbBroad304_08205 pLX_304 0% 87.7% 89.5% V5 (many diffs) n/a
6 TRCN0000474434 TGTTATAACTAGAAGTCTCCTGGT pLX_317 66.7% 87.7% 89.5% V5 (many diffs) n/a
Download CSV