Construct: ORF TRCN0000466078
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011179.1_s317c1
- Derived from:
- ccsbBroadEn_08813
- DNA Barcode:
- GCACGATCACTACGTGCCGCCTTG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAPB (63908)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466078
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63908 | NAPB | NSF attachment protein beta | NM_022080.2 | 99.7% | 99.3% | 869A>G;894delA |
| 2 | human | 63908 | NAPB | NSF attachment protein beta | NM_001283018.1 | 98.4% | 98% | 178_189del;881A>G;906delA |
| 3 | human | 63908 | NAPB | NSF attachment protein beta | NM_001283020.1 | 86.6% | 86.2% | 177_178ins117;752A>G;777delA |
| 4 | human | 63908 | NAPB | NSF attachment protein beta | XM_011529313.1 | 70.1% | 67.1% | (many diffs) |
| 5 | human | 63908 | NAPB | NSF attachment protein beta | XM_017028008.1 | 70.1% | 67.1% | (many diffs) |
| 6 | human | 63908 | NAPB | NSF attachment protein beta | NM_001283026.1 | 68.2% | 60.8% | (many diffs) |
| 7 | human | 63908 | NAPB | NSF attachment protein beta | XM_011529315.2 | 47.5% | 36% | (many diffs) |
| 8 | human | 63908 | NAPB | NSF attachment protein beta | NR_104266.2 | 24.5% | (many diffs) | |
| 9 | mouse | 17957 | Napb | N-ethylmaleimide sensitive ... | NM_019632.3 | 91% | 99.3% | (many diffs) |
| 10 | mouse | 17957 | Napb | N-ethylmaleimide sensitive ... | XM_011239346.1 | 62% | 62% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 960
- ORF length:
- 894
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga caacgcgggg aaggagcgtg aggcagtaca gctgatggcg gaggccgaga 121 agcgagtcaa ggcctcccac tccttcctcc gagggctgtt tggaggaaac acaagaatag 181 aagaggcttg tgaaatgtat accagagctg caaatatgtt caagatggct aaaaattgga 241 gtgctgcagg aaacgcattt tgtcaggcag ccaagctcca catgcagctt cagagcaaac 301 atgactctgc taccagcttt gtggatgctg gaaatgctta caaaaaggca gatccccaag 361 aggctatcaa ctgcttaaat gcagccatcg acatttacac agacatggga aggtttacaa 421 ttgcagccaa gcaccacatt actattgcag agatctatga gactgaactt gtagacattg 481 agaaggctat tgcacattat gaacaatctg ctgattatta caaaggagaa gaatccaaca 541 gcTCAGCAAA CAAGTGTCTG CTGAAGGTGG CAGCATATGC TGCCCAGCTT GAGCAGTACC 601 AGAAAGCCAT TGAGATCTAT GAGCAGGTTG GGGCAAACAC AATGGATAAT CCTTTGTTGA 661 AATACAGTGC AAAGGATTAC TTCTTCAAAG CTGCCCTCTG CCACTTCATA GTAGACGAGT 721 TGAATGCCAA GCTTGCTCTT GAGAAATATG AGGAAATGTT TCCAGCATTT ACTGATTCAA 781 GAGAATGTAA ATTATTGAAA AAACTCCTAG AAGCTCATGA AGAACAGAAC AGTGAAGCTT 841 ACACTGAAGC AGTGAAGGAA TTTGACTCAA TATCTCGCTT GGATCAGTGG CTGACCACCA 901 TGTTGCTTCG CATCAAAAAG TCCATCCAAG GGGGTGGAGA AGGAGATGGA GACCTAAATG 961 CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG 1021 TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT 1081 TTATATATCT TGTGGAAAGG ACGAGCACGA TCACTACGTG CCGCCTTGAC GCGTTAAGTC 1141 gacaatcaac ctctggatta caaaatttgt gaaagatt