Transcript: Human NM_001283020.1

Homo sapiens NSF attachment protein beta (NAPB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
NAPB (63908)
Length:
3754
CDS:
118..897

Additional Resources:

NCBI RefSeq record:
NM_001283020.1
NBCI Gene record:
NAPB (63908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001283020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229279 GCCAAGCACCACATTACTATT pLKO_005 361 CDS 100% 13.200 18.480 N NAPB n/a
2 TRCN0000065200 CCACATTACTATTGCAGAGAT pLKO.1 369 CDS 100% 4.950 6.930 N NAPB n/a
3 TRCN0000229278 AGGCTATCAACTGCTTAAATG pLKO_005 296 CDS 100% 13.200 10.560 N NAPB n/a
4 TRCN0000229280 ATGAACAATCTGCTGATTATT pLKO_005 434 CDS 100% 15.000 10.500 N NAPB n/a
5 TRCN0000313086 GAGGCTATCAACTGCTTAAAT pLKO_005 295 CDS 100% 15.000 10.500 N Napb n/a
6 TRCN0000255353 TCATGAACTTGATCCTATTAA pLKO_005 2035 3UTR 100% 15.000 10.500 N NAPB n/a
7 TRCN0000065202 GTGAAGGAATTTGACTCAATA pLKO.1 787 CDS 100% 13.200 9.240 N NAPB n/a
8 TRCN0000219008 AGAAAGCCATTGAGATCTATG pLKO_005 536 CDS 100% 10.800 7.560 N NAPB n/a
9 TRCN0000065199 GCAAAGGATTACTTCTTCAAA pLKO.1 604 CDS 100% 5.625 3.938 N NAPB n/a
10 TRCN0000065198 GCTGATTATTACAAAGGAGAA pLKO.1 445 CDS 100% 4.050 2.835 N NAPB n/a
11 TRCN0000065201 GCTCTTGAGAAATATGAGGAA pLKO.1 670 CDS 100% 2.640 1.848 N NAPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001283020.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08813 pDONR223 100% 86.6% 86.2% None 177_178ins117;752A>G;777delA n/a
2 ccsbBroad304_08813 pLX_304 0% 86.6% 86.2% V5 (not translated due to frame shift) 177_178ins117;752A>G;777delA n/a
3 TRCN0000466078 GCACGATCACTACGTGCCGCCTTG pLX_317 46.7% 86.6% 86.2% V5 (not translated due to frame shift) 177_178ins117;752A>G;777delA n/a
Download CSV